Entry information : AcoPrx34 (AcoGoldSmith_v1.008431m)
Entry ID 8591
Creation 2011-07-03 (Qiang Li)
Last sequence changes 2011-10-03 (Qiang Li)
Sequence status complete
Reviewer Qiang Li
Last annotation changes 2011-12-14 (Qiang Li)
Peroxidase information: AcoPrx34 (AcoGoldSmith_v1.008431m)
Name (synonym) AcoPrx34 (AcoGoldSmith_v1.008431m)
Class Class III peroxidase    [Orthogroup: Prx014]
Taxonomy Eukaryota Viridiplantae Streptophyta Ranunculaceae Aquilegia
Organism Aquilegia coerulea     [TaxId: 218851 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value AcoPrx34
start..stop
S start..stop
AfpPrx14 676 0 1..325 1..325
VvPrx[P]60 420 8e-149 1..324 1..326
NtPrx06-1B 411 4e-145 10..324 12..331
EgrPrx126 410 5e-145 24..324 26..326
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 717990..718202 213 N° 2 717692..717883 192 N° 3 717431..717599 169 N° 4 716910..717313 404
complement(join(716910..717313,717431..717599,717692..717883,717990..718202))


exon

Literature and cross-references AcoPrx34 (AcoGoldSmith_v1.008431m)
DNA ref. Phytozome 12:   scaffold_26 (718202..716910)
Protein sequence: AcoPrx34 (AcoGoldSmith_v1.008431m)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   326 (302)
PWM (Da):   %s   36149.33 (33543.1) Transmb domain:   %s   i5-26o
PI (pH):   %s   8.54 (8.79) Peptide Signal:   %s   cut: 24 range:24-325
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MRSSFYFCCVTLVVLALIEVCTGAGLKLNFYCKTCPQFEKIVKNITWSRVASDPRMGAKLLRVHYHDCFVRGCDASLLLDSTSTNVAEKEARPNLSVLGFDVIDDIKTRLEEECPETVSCADIVALAARDAVSFQYKRPMWKVWTGRRDGNISLATEANNDNLPSASSNFTTLRQLFARKGLSVMDLVALSGAHTIGVSHCGVLGRRLFNFTGKGDVDPSIEPSYAEILRTKCSSPTRETTIDMDPESSLSFDSHYYRILNQKKGLFQSDAALLNNPISAKLTKLLQRPNVFFTYFARSMRHMGAIDVLTGKDGEIRKQCRVPNA*

Retrieve as FASTA  
Remarks Complete sequence from genomic.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAGGTCAAGCTTTTACTTCTGTTGTGTCACTCTTGTTGTTCTTGCACTAATTGAGGTATGCACTGGAGCTGGACTGAAGTTGAATTTCTATTGCAAGACCTGTCCTCAGTTCGAAAAA
ATTGTTAAGAATATAACATGGAGTAGGGTTGCATCTGACCCTAGAATGGGAGCAAAGCTACTAAGGGTGCACTACCATGACTGCTTTGTCAGG
GTATTAATTTATACTTAATTGTAATAT
TATGTTGATGTTTAATTATATATGTATTTGATCATATCGAACGTGTTTATACTGATATATGTTTTTTCATCTCTGGCAGGGTTGTGATGCATCATTACTATTAGATTCAACATCAACAAA
TGTAGCCGAGAAAGAAGCTAGACCAAATTTATCTGTACTTGGTTTTGATGTAATAGATGATATCAAAACACGACTAGAGGAAGAATGTCCAGAGACTGTTTCATGTGCTGATATTGTTGC
TTTGGCTGCCCGAGACGCAGTTTCCTTTCAA
GTAAGCATGTTTTGAAGTTTCACATATGTAAGATCGAGTTCTTTTTATATGTATGAACACCTCAACATATATGTGATCATACTATTTTG
TAGTACAAGAGACCAATGTGGAAGGTTTGGACTGGGAGAAGAGATGGAAATATATCACTTGCAACTGAAGCAAACAACGATAATTTACCTTCAGCATCATCAAATTTCACCACCCTCAGA
CAGCTCTTTGCCAGAAAAGGACTCAGTGTCATGGACCTTGTAGCATTATCAG
GTAAAAATAAGGTTAAATATATAGAAATTACGCACTTTTGCCTATCATTTTTCGTTCAAAGTGCAAAA
TCTATACGTAATATGCGCATGAATTGTTCTTAAAATCTGAAATGAACAGGTGCACATACCATTGGGGTGTCACATTGCGGCGTCCTAGGACGTAGACTCTTCAATTTTACTGGAAAGGGT
GATGTGGATCCTTCTATCGAGCCAAGCTATGCAGAGATTTTAAGGACTAAATGTTCCAGTCCAACCAGGGAAACTACCATAGACATGGACCCTGAGAGCTCCCTCTCTTTTGATAGCCAT
TATTACAGGATTCTCAACCAAAAGAAAGGTCTATTTCAATCCGATGCAGCTCTTCTTAATAATCCAATTTCAGCCAAGCTCACCAAACTGCTACAGCGTCCTAATGTTTTCTTCACTTAT
TTCGCAAGATCAATGAGACATATGGGAGCCATTGATGTACTTACTGGTAAAGATGGTGAGATTAGGAAGCAATGTCGGGTTCCAAATGCTTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAGGTCAAGCTTTTACTTCTGTTGTGTCACTCTTGTTGTTCTTGCACTAATTGAGGTATGCACTGGAGCTGGACTGAAGTTGAATTTCTATTGCAAGACCTGTCCTCAGTTCGAAAAA
ATTGTTAAGAATATAACATGGAGTAGGGTTGCATCTGACCCTAGAATGGGAGCAAAGCTACTAAGGGTGCACTACCATGACTGCTTTGTCAGG
GGTTGTGATGCATCATTACTATTAGAT
TCAACATCAACAAATGTAGCCGAGAAAGAAGCTAGACCAAATTTATCTGTACTTGGTTTTGATGTAATAGATGATATCAAAACACGACTAGAGGAAGAATGTCCAGAGACTGTTTCATGT
GCTGATATTGTTGCTTTGGCTGCCCGAGACGCAGTTTCCTTTCAA
TACAAGAGACCAATGTGGAAGGTTTGGACTGGGAGAAGAGATGGAAATATATCACTTGCAACTGAAGCAAACAAC
GATAATTTACCTTCAGCATCATCAAATTTCACCACCCTCAGACAGCTCTTTGCCAGAAAAGGACTCAGTGTCATGGACCTTGTAGCATTATCAG
GTGCACATACCATTGGGGTGTCACAT
TGCGGCGTCCTAGGACGTAGACTCTTCAATTTTACTGGAAAGGGTGATGTGGATCCTTCTATCGAGCCAAGCTATGCAGAGATTTTAAGGACTAAATGTTCCAGTCCAACCAGGGAAACT
ACCATAGACATGGACCCTGAGAGCTCCCTCTCTTTTGATAGCCATTATTACAGGATTCTCAACCAAAAGAAAGGTCTATTTCAATCCGATGCAGCTCTTCTTAATAATCCAATTTCAGCC
AAGCTCACCAAACTGCTACAGCGTCCTAATGTTTTCTTCACTTATTTCGCAAGATCAATGAGACATATGGGAGCCATTGATGTACTTACTGGTAAAGATGGTGAGATTAGGAAGCAATGT
CGGGTTCCAAATGCTTAA

Retrieve as FASTA