Entry information : AcoPrx37 (AcoGoldSmith_v1.008488m)
Entry ID 8594
Creation 2011-07-03 (Qiang Li)
Last sequence changes 2011-10-03 (Qiang Li)
Sequence status complete
Reviewer Qiang Li
Last annotation changes 2011-12-14 (Qiang Li)
Peroxidase information: AcoPrx37 (AcoGoldSmith_v1.008488m)
Name (synonym) AcoPrx37 (AcoGoldSmith_v1.008488m)
Class Class III peroxidase    [Orthogroup: Prx023]
Taxonomy Eukaryota Viridiplantae Streptophyta Ranunculaceae Aquilegia
Organism Aquilegia coerulea     [TaxId: 218851 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value AcoPrx37
start..stop
S start..stop
AfpPrx22 495 2e-179 1..270 1..267
MePrx135 475 2e-170 1..323 1..327
PpePrx79 459 5e-164 6..323 10..331
PtPrx97 457 6e-164 18..323 1..308
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 722956..723171 216 N° 2 723428..723610 183 N° 3 723802..723967 166 N° 4 724198..724604 407
join(722956..723171,723428..723610,723802..723967,724198..724604)


exon

Literature and cross-references AcoPrx37 (AcoGoldSmith_v1.008488m)
DNA ref. Phytozome 12:   scaffold_9 (722956..724604)
Protein sequence: AcoPrx37 (AcoGoldSmith_v1.008488m)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   324 (298)
PWM (Da):   %s   35104.79 (32371.2)  
PI (pH):   %s   6.36 (5.38) Peptide Signal:   %s   cut: 26 range:26-323
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MKAAVRNQSLVVALLVLLLSVSVKSQLTSDFYGTTCPNLLQIVRKEVRNAIKFEMRMAASLLRLHFHDCFVDGCDASILLDGTDAEKSAFANLNSARGFEVLDSVKNAVERACSGVVSCADIIAISARDAVVLSGGPSWKVLLGRRDGKVSNQTTANSALTTPFETVDQLTAKFAAVGLDTTDLVSLSGAHTIGLAKCSSFSHRLFNFSQTGAPDTTLETEMLRDLQSQCPLNGDTEKTVVFDRNSADLFDNHYFKNLVNGKGLLQTDQELFSATTTKSLVQSYSEDINLFFNDFRNSMIKMGNISPLTGSEGEIRKNCRVIN*

Retrieve as FASTA  
Remarks Complete sequence from genomic.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAAGGCAGCCGTTAGAAATCAATCATTAGTTGTAGCATTGCTCGTGTTATTGTTGAGTGTATCTGTAAAATCCCAATTGACTTCTGATTTTTACGGTACAACATGCCCAAATCTTCTT
CAAATTGTCCGGAAAGAAGTCAGGAATGCAATCAAATTTGAAATGCGAATGGCCGCTTCTTTGCTTCGACTGCACTTTCATGATTGCTTCGTAGAT
GTTAGTTTTGCATTCACTTCTTTT
CCTATTCATTTCCTACGTGTAAACATCTTGTTCTTGAATATGCATGCATGTATATCTCTTCTTCAACAGGCTTCGGGTAGCAAATTAATCTTACTTTTATTTTGGATCAACATGTGTAAC
TAGCAAATATAACAATTGTAGCTCTAGATTTTACATTTAAATGTATTTCATGTTATCTTGCATAATCATTTAGTTATTATTTGTCATTTCTTTGTCATACTTTTTCTTACAGGGCTGTGA
TGCATCTATTCTACTAGACGGTACTGATGCAGAGAAGTCCGCCTTTGCTAACCTCAATTCAGCACGAGGATTTGAAGTTTTGGATAGTGTAAAGAATGCTGTTGAACGTGCATGCAGCGG
AGTTGTCTCATGTGCTGATATAATTGCTATCAGTGCCAGAGATGCTGTCGTCTTG
GTATGTATGTTCGAGCTGAGATTATCTCTATTTCATAGGTCCAATATGTTTGTTTGATTACCAGC
TTTACCGATCAACGTGTGCATGTATAGGTATTACGATGTGATCAAATCTAAATGTAAATGTTCGCCATAGGCTTTGAATTGATTCAATGTTATGTGCTAACCGATGTAGGACTGGTTGTC
TTGCAGAGCGGAGGGCCTTCATGGAAAGTCCTCCTAGGAAGAAGGGATGGTAAAGTATCCAATCAGACAACAGCCAATTCTGCTCTTACTACTCCCTTCGAGACTGTTGATCAACTAACC
GCAAAATTTGCTGCAGTAGGTCTCGACACCACAGACCTTGTGTCTTTATCGG
GTAATTAATCACAATCAAACTCAATTGGGGAACACAGTTCATACTGTAAGAGATTTTTATTAAGGCAC
AGATTTGTCATTTGTTGGAGGTTTAGGATAGGGTTTTATGATCTTTAACTGTGACTCGATGGGTGCCAAGGAGATGTAAAGGAAACGGGTTCCCATGGAGAGAGTTATTGTTACCAGGTT
TAAACTTTAAAGAGAGCTAATGTTTGTATTATTCTTGTGCAGGGGCTCATACCATCGGTTTAGCTAAGTGTTCCAGTTTCAGTCATAGACTGTTCAATTTCTCCCAAACAGGTGCTCCAG
ACACAACATTGGAAACAGAAATGTTAAGGGATTTGCAAAGCCAATGCCCACTGAATGGCGATACCGAGAAGACCGTTGTTTTTGACCGAAACTCAGCAGATTTGTTTGATAACCATTACT
TCAAAAACCTTGTCAATGGAAAGGGCCTTCTCCAAACCGATCAAGAACTATTCTCTGCTACAACTACTAAAAGTCTAGTTCAAAGCTACAGCGAGGATATAAACCTTTTCTTTAATGACT
TTCGCAACTCCATGATCAAAATGGGTAACATAAGTCCTCTAACTGGATCTGAAGGGGAGATTCGCAAGAACTGCAGGGTTATTAATTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAAGGCAGCCGTTAGAAATCAATCATTAGTTGTAGCATTGCTCGTGTTATTGTTGAGTGTATCTGTAAAATCCCAATTGACTTCTGATTTTTACGGTACAACATGCCCAAATCTTCTT
CAAATTGTCCGGAAAGAAGTCAGGAATGCAATCAAATTTGAAATGCGAATGGCCGCTTCTTTGCTTCGACTGCACTTTCATGATTGCTTCGTAGAT
GGCTGTGATGCATCTATTCTACTA
GACGGTACTGATGCAGAGAAGTCCGCCTTTGCTAACCTCAATTCAGCACGAGGATTTGAAGTTTTGGATAGTGTAAAGAATGCTGTTGAACGTGCATGCAGCGGAGTTGTCTCATGTGCT
GATATAATTGCTATCAGTGCCAGAGATGCTGTCGTCTTG
AGCGGAGGGCCTTCATGGAAAGTCCTCCTAGGAAGAAGGGATGGTAAAGTATCCAATCAGACAACAGCCAATTCTGCTCTT
ACTACTCCCTTCGAGACTGTTGATCAACTAACCGCAAAATTTGCTGCAGTAGGTCTCGACACCACAGACCTTGTGTCTTTATCGG
GGGCTCATACCATCGGTTTAGCTAAGTGTTCCAGT
TTCAGTCATAGACTGTTCAATTTCTCCCAAACAGGTGCTCCAGACACAACATTGGAAACAGAAATGTTAAGGGATTTGCAAAGCCAATGCCCACTGAATGGCGATACCGAGAAGACCGTT
GTTTTTGACCGAAACTCAGCAGATTTGTTTGATAACCATTACTTCAAAAACCTTGTCAATGGAAAGGGCCTTCTCCAAACCGATCAAGAACTATTCTCTGCTACAACTACTAAAAGTCTA
GTTCAAAGCTACAGCGAGGATATAAACCTTTTCTTTAATGACTTTCGCAACTCCATGATCAAAATGGGTAACATAAGTCCTCTAACTGGATCTGAAGGGGAGATTCGCAAGAACTGCAGG
GTTATTAATTGA

Retrieve as FASTA