Entry information : AcoPrx38 (AcoGoldSmith_v1.008513m)
Entry ID 8595
Creation 2011-07-03 (Qiang Li)
Last sequence changes 2011-10-03 (Qiang Li)
Sequence status complete
Reviewer Qiang Li
Last annotation changes 2011-12-14 (Qiang Li)
Peroxidase information: AcoPrx38 (AcoGoldSmith_v1.008513m)
Name (synonym) AcoPrx38 (AcoGoldSmith_v1.008513m)
Class Class III peroxidase    [Orthogroup: Prx134]
Taxonomy Eukaryota Viridiplantae Streptophyta Ranunculaceae Aquilegia
Organism Aquilegia coerulea     [TaxId: 218851 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value AcoPrx38
start..stop
S start..stop
AcoPrx90 588 0 7..322 2..317
AcoPrx72 506 0 8..322 3..319
AcoPrx65 493 6e-178 8..322 3..315
AcoPrx94 486 5e-175 8..311 3..307
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 1716635..1716871 237 N° 2 1716344..1716523 180 N° 3 1715679..1716230 552  
complement(join(1715679..1716230,1716344..1716523,1716635..1716871))


exon

Literature and cross-references AcoPrx38 (AcoGoldSmith_v1.008513m)
DNA ref. Phytozome 12:   scaffold_2 (1716871..1715679)
Protein sequence: AcoPrx38 (AcoGoldSmith_v1.008513m)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   323 (290)
PWM (Da):   %s   34400.22 (30902.4) Transmb domain:   %s   i13-32o
PI (pH):   %s   8.21 (8.20) Peptide Signal:   %s   cut: 33 range:33-322
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MTSITTTTTTHSTVFLSLLVIFLTTFSSPALAQLSVSFYGSTCPSVFDTVRAATRSAINREARMGASILRLFFHDCFVGGCDGGILLAGGERNAPANGDTVRGFDVIDNIKRQVDAACGRSVVSCADILAISARDSIIELGGQSYSIPLGRRDTRTPNIAAARSDLPAPFDPLNIIINKFSRKGFSAREMVALSGAHTVGLARCSSFKNRIYNETNIDPAFAASRQANCPQTGGDSNLAPLDPQSPNRFGNNYFQALLSRRGLLSSDQVLFNGGSTDSIVRTYSDDADAFSTDFTNAMIKMGNLSPLTGTQGEIRTTCQRVN*

Retrieve as FASTA  
Remarks Complete sequence from genomic.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGACTAGTATTACTACTACTACTACAACTCATTCCACTGTTTTTTTAAGTCTTTTGGTGATATTTCTTACCACCTTTTCATCTCCTGCCCTTGCACAACTCTCAGTCTCCTTTTATGGT
AGTACATGCCCATCAGTTTTTGACACTGTTCGAGCAGCCACACGTTCGGCTATAAACAGAGAAGCTCGAATGGGGGCTTCTATTTTACGCCTATTCTTCCACGATTGTTTTGTTGGT
GTA
AGTTGAATTTATATATCAACTTCTGTGGTTGTGCAGTATACTAATTATGTATTTATAACATTTTGAATACTTTAAATTGAATTGTTGATTCACGCTTAATGAATTCAGGGTTGTGATGGA
GGGATTCTTTTGGCTGGTGGTGAAAGAAATGCGCCAGCTAATGGAGATACGGTAAGAGGATTCGATGTTATTGACAACATAAAAAGACAAGTTGATGCCGCGTGTGGTCGAAGTGTTGTC
TCATGTGCAGATATCCTAGCCATTAGTGCCCGCGACTCCATTATTGAA
GTAAGCCATTCTGATAATACATAATTGCATCAATATATACTTATGTATGTACTCCATTGCTGCTATCTCTTT
GTTATTAACTAATTACCATCAATTCTTATTATCAATTTCAGCTTGGAGGACAGAGTTATTCAATTCCGCTAGGAAGGAGAGATACAAGAACTCCAAACATTGCAGCAGCAAGAAGTGATC
TTCCAGCTCCATTTGACCCTCTTAATATAATTATCAACAAATTCAGTCGAAAAGGATTTAGTGCGAGGGAGATGGTAGCATTATCTGGAGCACACACAGTAGGCCTAGCCCGATGTTCAT
CTTTTAAAAACCGAATCTATAATGAAACCAACATTGATCCTGCCTTTGCAGCATCTAGACAGGCTAATTGTCCTCAAACTGGCGGAGACAGCAACTTAGCTCCTTTAGACCCTCAAAGCC
CGAACCGATTTGGTAACAATTATTTCCAAGCATTGTTGAGCAGAAGAGGTCTGCTTAGTTCTGATCAGGTGTTATTCAATGGTGGTTCAACGGATTCTATTGTAAGGACATATAGTGATG
ACGCTGATGCCTTTTCAACAGATTTCACAAACGCAATGATTAAAATGGGGAACTTGAGTCCCTTAACTGGTACCCAAGGCGAAATTCGCACTACCTGTCAAAGGGTTAATTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGACTAGTATTACTACTACTACTACAACTCATTCCACTGTTTTTTTAAGTCTTTTGGTGATATTTCTTACCACCTTTTCATCTCCTGCCCTTGCACAACTCTCAGTCTCCTTTTATGGT
AGTACATGCCCATCAGTTTTTGACACTGTTCGAGCAGCCACACGTTCGGCTATAAACAGAGAAGCTCGAATGGGGGCTTCTATTTTACGCCTATTCTTCCACGATTGTTTTGTTGGT
GGT
TGTGATGGAGGGATTCTTTTGGCTGGTGGTGAAAGAAATGCGCCAGCTAATGGAGATACGGTAAGAGGATTCGATGTTATTGACAACATAAAAAGACAAGTTGATGCCGCGTGTGGTCGA
AGTGTTGTCTCATGTGCAGATATCCTAGCCATTAGTGCCCGCGACTCCATTATTGAA
CTTGGAGGACAGAGTTATTCAATTCCGCTAGGAAGGAGAGATACAAGAACTCCAAACATTGCA
GCAGCAAGAAGTGATCTTCCAGCTCCATTTGACCCTCTTAATATAATTATCAACAAATTCAGTCGAAAAGGATTTAGTGCGAGGGAGATGGTAGCATTATCTGGAGCACACACAGTAGGC
CTAGCCCGATGTTCATCTTTTAAAAACCGAATCTATAATGAAACCAACATTGATCCTGCCTTTGCAGCATCTAGACAGGCTAATTGTCCTCAAACTGGCGGAGACAGCAACTTAGCTCCT
TTAGACCCTCAAAGCCCGAACCGATTTGGTAACAATTATTTCCAAGCATTGTTGAGCAGAAGAGGTCTGCTTAGTTCTGATCAGGTGTTATTCAATGGTGGTTCAACGGATTCTATTGTA
AGGACATATAGTGATGACGCTGATGCCTTTTCAACAGATTTCACAAACGCAATGATTAAAATGGGGAACTTGAGTCCCTTAACTGGTACCCAAGGCGAAATTCGCACTACCTGTCAAAGG
GTTAATTAA

Retrieve as FASTA