Entry information : AcoPrx43 (AcoGoldSmith_v1.008729m)
Entry ID 8599
Creation 2011-07-03 (Qiang Li)
Last sequence changes 2011-10-03 (Qiang Li)
Sequence status complete
Reviewer Qiang Li
Last annotation changes 2011-12-14 (Qiang Li)
Peroxidase information: AcoPrx43 (AcoGoldSmith_v1.008729m)
Name (synonym) AcoPrx43 (AcoGoldSmith_v1.008729m)
Class Class III peroxidase    [Orthogroup: Prx015]
Taxonomy Eukaryota Viridiplantae Streptophyta Ranunculaceae Aquilegia
Organism Aquilegia coerulea     [TaxId: 218851 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value AcoPrx43
start..stop
S start..stop
AfpPrx24 648 0 1..316 1..316
NnPrx64 530 0 1..316 1..316
VvPrx64 530 0 22..313 28..319
CsPrx27 522 0 1..316 1..317
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 147501..147704 204 N° 2 147802..147990 189 N° 3 148125..148287 163 N° 4 148375..148769 395
join(147501..147704,147802..147990,148125..148287,148375..148769)


exon

Literature and cross-references AcoPrx43 (AcoGoldSmith_v1.008729m)
DNA ref. Phytozome 12:   scaffold_75 (147501..148769)
Protein sequence: AcoPrx43 (AcoGoldSmith_v1.008729m)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   317 (292)
PWM (Da):   %s   33908.08 (31261.7)  
PI (pH):   %s   8.33 (8.40) Peptide Signal:   %s   cut: 25 range:25-316
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAAIVVLFCTLIFSSLSFFGNALSSNYYDKTCPNAEEAITNAVKNAINNDQTVPAALLRMHFHDCFIRGCDASVLLKSVGKNTAEKDGPPNISLHAFYVIDNAKKAVEDLCPGVVSCADILALAARDAVALSGGPTWDVPKGRLDGRVSKATETRSLPAPTFNISQLQQSFSQRGLSMKDLVALSGGHTLGFSHCSSFQSRIHNFNATFDVDPTMHPAFAASLKSICPLHNKAKNAGATMDPSTAIFDNTYFKLLLQGRSLFSSDQSLLTTTKTKALVSKFASSQEAFADAFVKSMIKMSSLNGGQEVRLDCKVVN*

Retrieve as FASTA  
Remarks Complete sequence from genomic.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCAGCCATTGTTGTTCTGTTCTGCACTCTCATCTTCTCATCACTTTCTTTTTTTGGAAATGCATTGAGCTCAAATTACTATGATAAAACATGCCCCAATGCTGAGGAGGCCATTACT
AATGCAGTTAAGAACGCGATAAATAATGACCAGACAGTGCCTGCTGCACTTCTTCGGATGCACTTTCACGATTGCTTCATTAGA
GTATATATACATCTTCTTCTCATACATGCTTTCATA
TATTAAGTTTAATGCATCGTTTAGTCCATTTGGCTTAATGCATGTGTTCTGTTTTTTGTAGGGGTGTGATGCATCTGTACTCCTAAAATCAGTAGGAAAGAACACTGCAGAAAAGGATGG
ACCTCCTAATATTTCTTTACATGCATTTTATGTCATCGACAATGCGAAAAAAGCAGTCGAAGATTTGTGTCCTGGTGTGGTCTCATGTGCAGATATATTGGCTCTAGCTGCAAGGGATGC
AGTAGCACTA
GTAAGTTATATATATTTAGGCTACCTCACAATTCACATATGTAACGACATGTGGTACTCCACATTATTCTTCAAATGTCGTACTCATTATTCTTCATGATCGATAATTTA
GTAACCATATATCCATTTTTACAGTCTGGAGGTCCTACATGGGATGTGCCCAAAGGAAGATTAGATGGAAGAGTATCGAAGGCAACTGAAACTAGGTCTTTACCAGCTCCCACCTTCAAC
ATTTCTCAATTGCAACAAAGCTTCTCTCAAAGAGGTCTATCCATGAAAGATCTAGTTGCTCTCTCAG
GTAATAATTTAGCAAAAATCAATCTTGCTACAGAAGTACAGAATATAAGTTTT
GATCAATGGACTAATTTAACTTTGACATTTGTAGGAGGACACACCCTTGGATTCTCTCACTGCTCATCCTTTCAAAGCAGAATTCACAACTTCAACGCTACATTCGATGTTGATCCCACC
ATGCACCCAGCCTTTGCAGCAAGCTTAAAGAGCATTTGTCCACTACACAACAAAGCCAAAAATGCAGGTGCCACCATGGATCCATCTACAGCTATCTTTGATAATACTTACTTCAAGCTA
TTACTTCAGGGTAGATCACTATTTTCTTCAGATCAATCTCTGCTCACTACAACGAAGACCAAGGCTTTGGTTTCCAAGTTTGCTAGCTCTCAGGAAGCTTTTGCAGATGCTTTTGTCAAG
TCCATGATCAAGATGAGTAGCCTAAATGGTGGACAAGAAGTGAGATTAGATTGCAAAGTTGTTAATTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCAGCCATTGTTGTTCTGTTCTGCACTCTCATCTTCTCATCACTTTCTTTTTTTGGAAATGCATTGAGCTCAAATTACTATGATAAAACATGCCCCAATGCTGAGGAGGCCATTACT
AATGCAGTTAAGAACGCGATAAATAATGACCAGACAGTGCCTGCTGCACTTCTTCGGATGCACTTTCACGATTGCTTCATTAGA
GGGTGTGATGCATCTGTACTCCTAAAATCAGTAGGA
AAGAACACTGCAGAAAAGGATGGACCTCCTAATATTTCTTTACATGCATTTTATGTCATCGACAATGCGAAAAAAGCAGTCGAAGATTTGTGTCCTGGTGTGGTCTCATGTGCAGATATA
TTGGCTCTAGCTGCAAGGGATGCAGTAGCACTA
TCTGGAGGTCCTACATGGGATGTGCCCAAAGGAAGATTAGATGGAAGAGTATCGAAGGCAACTGAAACTAGGTCTTTACCAGCTCCC
ACCTTCAACATTTCTCAATTGCAACAAAGCTTCTCTCAAAGAGGTCTATCCATGAAAGATCTAGTTGCTCTCTCAG
GAGGACACACCCTTGGATTCTCTCACTGCTCATCCTTTCAAAGC
AGAATTCACAACTTCAACGCTACATTCGATGTTGATCCCACCATGCACCCAGCCTTTGCAGCAAGCTTAAAGAGCATTTGTCCACTACACAACAAAGCCAAAAATGCAGGTGCCACCATG
GATCCATCTACAGCTATCTTTGATAATACTTACTTCAAGCTATTACTTCAGGGTAGATCACTATTTTCTTCAGATCAATCTCTGCTCACTACAACGAAGACCAAGGCTTTGGTTTCCAAG
TTTGCTAGCTCTCAGGAAGCTTTTGCAGATGCTTTTGTCAAGTCCATGATCAAGATGAGTAGCCTAAATGGTGGACAAGAAGTGAGATTAGATTGCAAAGTTGTTAATTAG

Retrieve as FASTA