Entry information : AcoPrx51 (AcoGoldSmith_v1.013017m)
Entry ID 8601
Creation 2011-07-03 (Qiang Li)
Last sequence changes 2011-10-03 (Qiang Li)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2015-10-15 (Christophe Dunand)
Peroxidase information: AcoPrx51 (AcoGoldSmith_v1.013017m)
Name (synonym) AcoPrx51 (AcoGoldSmith_v1.013017m)
Class Class III peroxidase    [Orthogroup: Prx098]
Taxonomy Eukaryota Viridiplantae Streptophyta Ranunculaceae Aquilegia
Organism Aquilegia coerulea     [TaxId: 218851 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value AcoPrx51
start..stop
S start..stop
AcoPrx101 591 0 1..326 1..319
AfpPrx23 524 0 1..328 1..330
AcoPrx23 524 0 1..328 1..330
AcoPrx63 524 0 1..326 1..327
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 1566082..1566312 231 N° 2 1566397..1566591 195 N° 3 1566722..1567282 561  
join(1566082..1566312,1566397..1566591,1566722..1567282)


exon

Literature and cross-references AcoPrx51 (AcoGoldSmith_v1.013017m)
DNA ref. Phytozome 12:   scaffold_2 (1566082..1567282)
Protein sequence: AcoPrx51 (AcoGoldSmith_v1.013017m)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   329 (298)
PWM (Da):   %s   35243.38 (31818.7) Transmb domain:   %s   i13-35o
PI (pH):   %s   7.22 (6.74) Peptide Signal:   %s   cut: 31 range:31-328
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MATPSNCSKQYSKFFVLVVFFTTMSTPVLAQLSVGFYASTCPSVLDTVRSATRSAINREARMGASLIRLFFHDCFVNGCDGGVLLDDTTSVPGEKTVLPNSGSARGFEVIDTIKTQVDRACGGSVVSCADILAIAARDSVVELGGPSYSVPLGRRDARAPNRAGMSGLPGFFENLGPLLSKFSAKGFSAQEMVALSGAHTVGQARCVVYRDRIYNETNIDPAYATSLQANCPRATGTNDETLAPLDPQSPNRFGNNYFQALINRRTILHSDQELFNGGSTDSIVRDYSDNPATFSTDFANAMVKMGNMSPLTGTQGEIRRDCKRINEV*

Retrieve as FASTA  
Remarks Complete sequence from genomic (introns 1 and 2).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCCACTCCTAGTAATTGCTCGAAGCAATACAGCAAGTTTTTTGTCCTCGTCGTCTTCTTTACAACCATGTCAACCCCTGTTTTAGCACAGCTCTCAGTTGGTTTCTATGCTTCTACA
TGTCCATCAGTACTCGACACTGTCCGTAGTGCAACACGATCTGCCATCAATAGAGAAGCTCGTATGGGGGCATCTCTTATTCGTCTCTTCTTCCATGACTGTTTTGTAAAC
GTATGTTCT
GTCACTTTACTCAGGGCTTATTATATTACTCTTGCTTCAATCATGCATTTATATTTGATTGAATGTTTCATGCAGGGATGTGATGGAGGAGTTCTTTTGGACGACACAACATCAGTTCCT
GGCGAAAAAACTGTACTGCCTAATTCAGGCTCAGCCAGAGGGTTTGAGGTGATCGATACCATCAAGACACAAGTTGATAGAGCCTGTGGAGGCTCTGTAGTGTCCTGTGCTGACATTTTG
GCAATTGCAGCGCGCGATTCTGTTGTGGAA
GTGAGTATTTTGTTTTATATTTACTAACTAACATCCATGCAAGTACATCTATTGGTACATGAAATACGAAAAGGGAAGAAATAATAAAAA
CAAAATTGAAATTAAATTGTGTTTTCTTTGGATGCAACAGCTTGGAGGACCATCTTATTCAGTTCCACTGGGAAGAAGAGATGCTAGAGCCCCAAATAGAGCTGGAATGAGTGGTCTTCC
AGGATTTTTCGAAAACCTTGGACCACTTCTCTCTAAATTCAGTGCTAAGGGATTTAGTGCTCAAGAAATGGTTGCACTGTCTGGTGCACACACAGTTGGTCAAGCCCGTTGTGTAGTATA
TAGAGACCGAATCTACAACGAAACCAATATTGATCCTGCATATGCAACATCACTACAGGCTAATTGCCCGCGTGCTACAGGAACTAACGATGAAACTTTGGCCCCTTTAGACCCTCAAAG
TCCAAATCGATTTGGAAATAATTATTTCCAAGCATTGATCAATAGAAGGACAATTCTACATTCTGACCAGGAACTATTTAACGGTGGATCTACAGATTCTATTGTAAGAGATTATAGTGA
CAATCCTGCTACTTTCTCAACTGATTTTGCCAATGCTATGGTGAAGATGGGGAATATGAGTCCTTTGACTGGTACCCAAGGCGAGATTCGAAGAGATTGTAAAAGGATCAATGAAGTGTA
A

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCCACTCCTAGTAATTGCTCGAAGCAATACAGCAAGTTTTTTGTCCTCGTCGTCTTCTTTACAACCATGTCAACCCCTGTTTTAGCACAGCTCTCAGTTGGTTTCTATGCTTCTACA
TGTCCATCAGTACTCGACACTGTCCGTAGTGCAACACGATCTGCCATCAATAGAGAAGCTCGTATGGGGGCATCTCTTATTCGTCTCTTCTTCCATGACTGTTTTGTAAAC
GGATGTGAT
GGAGGAGTTCTTTTGGACGACACAACATCAGTTCCTGGCGAAAAAACTGTACTGCCTAATTCAGGCTCAGCCAGAGGGTTTGAGGTGATCGATACCATCAAGACACAAGTTGATAGAGCC
TGTGGAGGCTCTGTAGTGTCCTGTGCTGACATTTTGGCAATTGCAGCGCGCGATTCTGTTGTGGAA
CTTGGAGGACCATCTTATTCAGTTCCACTGGGAAGAAGAGATGCTAGAGCCCCA
AATAGAGCTGGAATGAGTGGTCTTCCAGGATTTTTCGAAAACCTTGGACCACTTCTCTCTAAATTCAGTGCTAAGGGATTTAGTGCTCAAGAAATGGTTGCACTGTCTGGTGCACACACA
GTTGGTCAAGCCCGTTGTGTAGTATATAGAGACCGAATCTACAACGAAACCAATATTGATCCTGCATATGCAACATCACTACAGGCTAATTGCCCGCGTGCTACAGGAACTAACGATGAA
ACTTTGGCCCCTTTAGACCCTCAAAGTCCAAATCGATTTGGAAATAATTATTTCCAAGCATTGATCAATAGAAGGACAATTCTACATTCTGACCAGGAACTATTTAACGGTGGATCTACA
GATTCTATTGTAAGAGATTATAGTGACAATCCTGCTACTTTCTCAACTGATTTTGCCAATGCTATGGTGAAGATGGGGAATATGAGTCCTTTGACTGGTACCCAAGGCGAGATTCGAAGA
GATTGTAAAAGGATCAATGAAGTGTAA

Retrieve as FASTA