Entry information : AcoPrx54 ( Aqcoe5G373900 [3.0]/ AcoGoldSmith_v1.013585m [1.0])
Entry ID 8604
Creation 2011-07-03 (Qiang Li)
Last sequence changes 2016-02-04 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2016-02-04 (Christophe Dunand)
Peroxidase information: AcoPrx54 ( Aqcoe5G373900 [3.0]/ AcoGoldSmith_v1.013585m [1.0])
Name (synonym) AcoPrx54 ( Aqcoe5G373900 [3.0]/ AcoGoldSmith_v1.013585m [1.0])
Class Class III peroxidase    [Orthogroup: Prx221]
Taxonomy Eukaryota Viridiplantae Streptophyta Ranunculaceae Aquilegia
Organism Aquilegia coerulea     [TaxId: 218851 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value AcoPrx54
start..stop
S start..stop
AcoPrx103 872 0 1..441 1..442
AcoPrx102 321 6e-110 224..414 1..195
AfpPrx11 271 9e-88 32..218 22..219
AcoPrx06 271 9e-88 32..217 22..218
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 4111718..4112038 321 N° 2 4112167..4112358 192 N° 3 4112460..4113275 816  
join(4111718..4112038,4112167..4112358,4112460..4113275)


exon

Literature and cross-references AcoPrx54 ( Aqcoe5G373900 [3.0]/ AcoGoldSmith_v1.013585m [1.0])
DNA ref. Phytozome 12:   scaffold_11 (4111718..4113272)
Protein sequence: AcoPrx54 ( Aqcoe5G373900 [3.0]/ AcoGoldSmith_v1.013585m [1.0])
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   442 (426)
PWM (Da):   %s   48843.75 (47074.8)  
PI (pH):   %s   6.31 (6.31) Peptide Signal:   %s   cut: 16 range:16-441
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MWVILPSIILSCVASSSVPGKKQSVSLLLFLGKQSGEQINNGSSSFSWIPSLLYFNNEIKIGDSIDFEYDYYNDEELVESMMRYLYKTQTDVTPALLCLVFHDFLIQKRDGSVLMDSPNAGNQSEKDTVPNGSMKGFNIIEKSKSKVEEECPATVSYADILILAAREGIVLAGCPYYPVTTGRSNSLVSFPEIAAFDIPSPNDDLSKTITLFASRGFTSASSRDGNDNIMYIGGAEITQPNFFYNGTVVGHCLEGFISPFCDIERMTPLSFPSPQSDNRTNPRLINTLPSPAIMRLMIKDDMFRLHTTGFSVLNDPAIFSGGHAYRNNFRFHIVPNRLLTSADLMRLPTGTTLPTMDHSGDSLIITNGGSRGGQMRINYVRIKTPDVVYNLKIAVQSVLLPFPHLHSATVEFRGMEALALYMILPLRLVILLCLRQKGLCR*

Retrieve as FASTA  
Remarks Complete sequence from genomic.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTGGGTTATTCTTCCATCGATAATTCTAAGTTGTGTTGCGTCTTCCTCTGTTCCTGGAAAGAAACAGAGTGTCTCTTTACTTCTCTTTCTTGGTAAACAAAGTGGTGAACAGATAAAT
AATGGTAGTTCATCTTTTTCATGGATTCCTTCTCTTCTTTACTTCAATAACGAAATAAAGATCGGTGATTCTATTGATTTTGAATACGATTACTATAATGATGAAGAACTTGTTGAATCG
ATGATGCGATATCTTTACAAAACTCAAACTGATGTTACTCCAGCTTTATTGTGCTTGGTGTTTCATGATTTCTTGATTCAG
GTTTGTTTTTTAGCTAATTTACTGAATTTTTATCTTACA
ATGGGATTCTGATTTCATTAGGGTTTTAGTGGGTTTTGTGTTAATTTAATTTGATTTGATTGTTTTGAATGAAATGGGGATTCTTGTAGAAACGTGATGGATCTGTTCTAATGGATTCTC
CCAATGCTGGAAATCAATCTGAGAAAGATACTGTACCTAATGGGTCAATGAAAGGCTTCAATATAATCGAAAAAAGCAAATCCAAAGTCGAAGAAGAGTGTCCTGCAACAGTTTCTTACG
CTGATATTCTTATTCTTGCAGCTAGAGAAGGAATTGTTTTG
GTAATGCATTGATTATGTTGGTGTTTTGGTAATGTATTCATTATTTTGGTGTTTTGGTGTTTTCGTCGATTTGCTCTTC
TGATTGTTTGTTGTTATTGCAGGCTGGTTGTCCTTACTATCCTGTGACTACCGGAAGGAGTAATAGCCTTGTATCGTTTCCTGAAATTGCCGCTTTTGACATTCCATCTCCTAATGATGA
TCTTTCCAAGACCATTACATTATTTGCTAGTAGAGGATTTACTTCTGCAAGTAGCAGAGATGGANNNAATGATAATATCATGTACATTGGTGGAGCAGAGATCACTCAACCTAATTTCTT
CTACAACGGTACCGTAGTTGGTCATTGTCTTGAAGGTTTTATCTCTCCTTTTTGTGACATAGAAAGGATGACTCCTCTATCTTTTCCTTCTCCACAATCTGATAATCGCACAAATCCACG
ATTAATTAATACTCTGCCTTCCCCTGCTATTATGCGTCTGATGATTAAAGATGATATGTTTCGACTTCATACTACTGGTTTCAGTGTTCTTAATGATCCTGCAATCTTTTCTGGTGGCCA
TGCCTATCGTAACAATTTCAGATTCCATATCGTACCTAATCGCTTGTTAACGAGTGCTGATCTAATGAGGCTGCCAACAGGCACTACTTTGCCTACAATGGATCACAGTGGTGACTCCTT
GATAATTACTAATGGAGGAAGTAGAGGTGGTCAGATGAGGATCAATTACGTAAGAATCAAGACTCCTGATGTGGTTTACAATCTCAAGATTGCGGTTCAGAGTGTACTCTTGCCATTTCC
TCATCTTCATTCAGCTACTGTGGAGTTTCGAGGTATGGAGGCACTGGCACTTTATATGATTCTGCCGCTGCGGTTGGTGATCCTGCTATGTTTAAGACAAAAAGGGCTCTGCAGATAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTGGGTTATTCTTCCATCGATAATTCTAAGTTGTGTTGCGTCTTCCTCTGTTCCTGGAAAGAAACAGAGTGTCTCTTTACTTCTCTTTCTTGGTAAACAAAGTGGTGAACAGATAAAT
AATGGTAGTTCATCTTTTTCATGGATTCCTTCTCTTCTTTACTTCAATAACGAAATAAAGATCGGTGATTCTATTGATTTTGAATACGATTACTATAATGATGAAGAACTTGTTGAATCG
ATGATGCGATATCTTTACAAAACTCAAACTGATGTTACTCCAGCTTTATTGTGCTTGGTGTTTCATGATTTCTTGATTCAG
AAACGTGATGGATCTGTTCTAATGGATTCTCCCAATGCT
GGAAATCAATCTGAGAAAGATACTGTACCTAATGGGTCAATGAAAGGCTTCAATATAATCGAAAAAAGCAAATCCAAAGTCGAAGAAGAGTGTCCTGCAACAGTTTCTTACGCTGATATT
CTTATTCTTGCAGCTAGAGAAGGAATTGTTTTG
GCTGGTTGTCCTTACTATCCTGTGACTACCGGAAGGAGTAATAGCCTTGTATCGTTTCCTGAAATTGCCGCTTTTGACATTCCATCT
CCTAATGATGATCTTTCCAAGACCATTACATTATTTGCTAGTAGAGGATTTACTTCTGCAAGTAGCAGAGATGGANNNAATGATAATATCATGTACATTGGTGGAGCAGAGATCACTCAA
CCTAATTTCTTCTACAACGGTACCGTAGTTGGTCATTGTCTTGAAGGTTTTATCTCTCCTTTTTGTGACATAGAAAGGATGACTCCTCTATCTTTTCCTTCTCCACAATCTGATAATCGC
ACAAATCCACGATTAATTAATACTCTGCCTTCCCCTGCTATTATGCGTCTGATGATTAAAGATGATATGTTTCGACTTCATACTACTGGTTTCAGTGTTCTTAATGATCCTGCAATCTTT
TCTGGTGGCCATGCCTATCGTAACAATTTCAGATTCCATATCGTACCTAATCGCTTGTTAACGAGTGCTGATCTAATGAGGCTGCCAACAGGCACTACTTTGCCTACAATGGATCACAGT
GGTGACTCCTTGATAATTACTAATGGAGGAAGTAGAGGTGGTCAGATGAGGATCAATTACGTAAGAATCAAGACTCCTGATGTGGTTTACAATCTCAAGATTGCGGTTCAGAGTGTACTC
TTGCCATTTCCTCATCTTCATTCAGCTACTGTGGAGTTTCGAGGTATGGAGGCACTGGCACTTTATATGATTCTGCCGCTGCGGTTGGTGATCCTGCTATGTTTAAGACAAAAAGGGCTC
TGCAGATAA

Retrieve as FASTA