Entry information : AcoPrx55 (AcoGoldSmith_v1.013672m)
Entry ID 8605
Creation 2011-07-03 (Qiang Li)
Last sequence changes 2011-10-03 (Qiang Li)
Sequence status complete
Reviewer Qiang Li
Last annotation changes 2011-12-14 (Qiang Li)
Peroxidase information: AcoPrx55 (AcoGoldSmith_v1.013672m)
Name (synonym) AcoPrx55 (AcoGoldSmith_v1.013672m)
Class Class III peroxidase    [Orthogroup: Prx030]
Taxonomy Eukaryota Viridiplantae Streptophyta Ranunculaceae Aquilegia
Organism Aquilegia coerulea     [TaxId: 218851 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value AcoPrx55
start..stop
S start..stop
AfpPrx25 566 0 1..329 1..310
CsPrx39 468 9e-168 16..329 20..333
EgrPrx73 467 3e-167 16..329 12..326
EcamPrx73 465 1e-166 19..329 16..326
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 4338823..4339050 228 N° 2 4339140..4339319 180 N° 3 4339399..4339564 166 N° 4 4340280..4340695 416
join(4338823..4339050,4339140..4339319,4339399..4339564,4340280..4340695)


exon

Literature and cross-references AcoPrx55 (AcoGoldSmith_v1.013672m)
DNA ref. Phytozome 12:   scaffold_16 (4338823..4340695)
Protein sequence: AcoPrx55 (AcoGoldSmith_v1.013672m)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   330 (301)
PWM (Da):   %s   35920.76 (32713.1) Transmb domain:   %s   i7-29o
PI (pH):   %s   4.74 (4.80) Peptide Signal:   %s   cut: 29 range:29-329
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MELKSDLFYNILLASLFWVFSLSASSTSSNLSFNFYATSCPAAEIMIRNTVRSASESDPTIPGKLLRLLFHDCMVEGCDGSVLLEGNGTERSDPANRSVGGFSVVESAKRVLEIFCPETVSCADILALAARDAVEFAGGPIIQVPTGRRDGKVSSASNVRSNIIDTNFSLDEMIQHFSSKGLSVDDLVVLSGAHTIGLAHCSSIRGRFQEDPQGKTTLIDISLDQVYAAKLMQQCPADASVSVTIQNDPETSFMFDNQYYKNLLLHQGLFQSDSVLFSDERTKEKVVEFSSSQDSFFQSWETSFVKLTRMGVKTGNAGEIRRSCQTING*

Retrieve as FASTA  
Remarks Complete sequence from genomic.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGAGTTAAAATCTGATCTGTTCTACAACATTCTTTTAGCTTCTCTTTTCTGGGTATTCTCATTATCAGCTTCTTCTACTTCTTCGAATCTATCATTTAATTTCTATGCAACTTCATGT
CCAGCAGCAGAAATTATGATTAGAAACACTGTCAGATCAGCTTCTGAATCAGACCCAACAATACCTGGGAAACTTTTAAGGTTATTGTTTCATGACTGCATGGTAGAG
GTGAGATGCTAA
GTACAAAATGGTCATTATATAATGATACCAGACGAACTATTTTGTTGTTACGATATTTTGTTATTTAATATGTGAAGGGTTGCGATGGATCGGTGCTTTTAGAAGGAAATGGAACAGAAC
GGAGTGATCCGGCTAATAGATCAGTTGGTGGATTCTCAGTAGTTGAATCAGCAAAAAGAGTACTTGAAATCTTTTGTCCAGAAACAGTTTCTTGTGCTGATATACTTGCTTTGGCTGCTA
GAGATGCTGTTGAATTT
GTAAGATATCAATCACATTTCACTTCTGTAATAAGTACATGGAATTAGCTAACTAGAAATAGTTGTTGTTTTGAATTAGGCCGGTGGACCGATTATTCAGGTA
CCAACGGGTAGGAGAGATGGGAAGGTGTCTTCAGCTTCTAATGTCAGATCCAACATAATAGATACAAACTTTAGCCTGGATGAGATGATTCAACATTTTTCATCTAAGGGGTTGTCTGTA
GATGACCTTGTTGTTCTTTCAG
GTATATAATTTACATACTACATAAGCTAGCTAGTAAAGAAAATTACTTACATATACCAGAATCAGTCCTCCTTCACCACCGTGTACCTACATATTTCA
TTGCCTCATCAATGCTTAATTGATTGAACAGACTGAAGCCCATGTGATGGCACATTGGTACTAAAGTTTGTTACTACAAACAGTACATGGAGTTATGAAATTTTGATTCAAATGTACTAT
TTGAAATATAATAGTAGCCAGCCAGACTCTTATGACATTGTGCATTTCCAACAATTGTCAGGTGACTGTATATATTCTATGGTAGAAGACTTTCAACTTTGCAGCAGAGGTCATATAGGA
TTACAGTCATGCCTAATGCAATTTTCGACCGATTGGAGTAATTCTACACACCTAAATGACTAGCCGAGTCCTGACTACATACATACTCTTTATTTGGACTATTGTCCTGTTTTATAAATT
TTTGGCACGATTTTTAGAACCCTTGCCAAATAGGTAGAAATTTGCACTTGGTTACTATACAAAGTCGCAATGGTATATATAAATTGGGTAGACTTGTACAAAAACTCACGTTAGACACTC
AGACTGATAGTTCATGGATTTTTGCCTATAGACAGAGATCCTGAAGTCAGTTATCATTATTAAAGGCCAAAAGCATACCAGCGACTGTGATAGGCAGCATATTGAATTGTCTCAAACTGA
TGAATCTGTGCATGCAGGAGCTCATACCATAGGATTGGCACATTGCAGTTCAATTCGAGGCCGCTTTCAAGAGGACCCTCAAGGAAAGACGACACTTATTGACATATCTCTCGACCAAGT
ATATGCAGCAAAATTGATGCAACAATGCCCTGCAGATGCAAGTGTGTCTGTAACTATTCAGAATGATCCGGAAACATCCTTCATGTTTGATAACCAATATTATAAGAACCTTTTACTTCA
TCAAGGATTGTTTCAATCAGATTCAGTGTTGTTTAGTGATGAAAGAACGAAGGAAAAGGTAGTTGAATTCTCCAGCAGCCAAGACAGTTTCTTTCAGAGCTGGGAAACTTCGTTTGTCAA
GCTCACAAGGATGGGCGTAAAGACTGGTAATGCAGGGGAGATAAGAAGATCATGTCAAACAATAAATGGTTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGAGTTAAAATCTGATCTGTTCTACAACATTCTTTTAGCTTCTCTTTTCTGGGTATTCTCATTATCAGCTTCTTCTACTTCTTCGAATCTATCATTTAATTTCTATGCAACTTCATGT
CCAGCAGCAGAAATTATGATTAGAAACACTGTCAGATCAGCTTCTGAATCAGACCCAACAATACCTGGGAAACTTTTAAGGTTATTGTTTCATGACTGCATGGTAGAG
GGTTGCGATGGA
TCGGTGCTTTTAGAAGGAAATGGAACAGAACGGAGTGATCCGGCTAATAGATCAGTTGGTGGATTCTCAGTAGTTGAATCAGCAAAAAGAGTACTTGAAATCTTTTGTCCAGAAACAGTT
TCTTGTGCTGATATACTTGCTTTGGCTGCTAGAGATGCTGTTGAATTT
GCCGGTGGACCGATTATTCAGGTACCAACGGGTAGGAGAGATGGGAAGGTGTCTTCAGCTTCTAATGTCAGA
TCCAACATAATAGATACAAACTTTAGCCTGGATGAGATGATTCAACATTTTTCATCTAAGGGGTTGTCTGTAGATGACCTTGTTGTTCTTTCAG
GAGCTCATACCATAGGATTGGCACAT
TGCAGTTCAATTCGAGGCCGCTTTCAAGAGGACCCTCAAGGAAAGACGACACTTATTGACATATCTCTCGACCAAGTATATGCAGCAAAATTGATGCAACAATGCCCTGCAGATGCAAGT
GTGTCTGTAACTATTCAGAATGATCCGGAAACATCCTTCATGTTTGATAACCAATATTATAAGAACCTTTTACTTCATCAAGGATTGTTTCAATCAGATTCAGTGTTGTTTAGTGATGAA
AGAACGAAGGAAAAGGTAGTTGAATTCTCCAGCAGCCAAGACAGTTTCTTTCAGAGCTGGGAAACTTCGTTTGTCAAGCTCACAAGGATGGGCGTAAAGACTGGTAATGCAGGGGAGATA
AGAAGATCATGTCAAACAATAAATGGTTGA

Retrieve as FASTA