Entry information : AcoPrx64 (AcoGoldSmith_v1.018037m)
Entry ID 8612
Creation 2011-07-03 (Qiang Li)
Last sequence changes 2011-10-03 (Qiang Li)
Sequence status complete
Reviewer Qiang Li
Last annotation changes 2011-12-14 (Qiang Li)
Peroxidase information: AcoPrx64 (AcoGoldSmith_v1.018037m)
Name (synonym) AcoPrx64 (AcoGoldSmith_v1.018037m)
Class Class III peroxidase    [Orthogroup: Prx027]
Taxonomy Eukaryota Viridiplantae Streptophyta Ranunculaceae Aquilegia
Organism Aquilegia coerulea     [TaxId: 218851 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value AcoPrx64
start..stop
S start..stop
LePrx72 481 4e-173 1..320 1..320
PatrPrx01 476 3e-171 8..320 7..316
PtPrx53 474 2e-170 5..320 4..316
VvPrx20 473 4e-170 1..320 1..317
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 1188847..1189065 219 N° 2 1188555..1188746 192 N° 3 1187873..1188424 552  
complement(join(1187873..1188424,1188555..1188746,1188847..1189065))


exon

Literature and cross-references AcoPrx64 (AcoGoldSmith_v1.018037m)
DNA ref. Phytozome 12:   scaffold_39 (1189065..1187873)
Protein sequence: AcoPrx64 (AcoGoldSmith_v1.018037m)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   321 (294)
PWM (Da):   %s   34190.89 (31293.6)  
PI (pH):   %s   8.26 (8.40) Peptide Signal:   %s   cut: 27 range:27-320
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MASFTSCFVTFSMVFLLLACSSTTHAQLSATFYATSCPNLQTIVNTAMTQAVNNQQRMGASILRLFFHDCFVQGCDASILLDDTATFTGEKNAGPNANSVRGFEVIDTIKTRVEAACNATVSCADILALAARDGTVALGGPTWTVALGRRDSRTASQSAANSQIPSPAASLATLTSSFSAKGLNARDLTALSGAHTIGQARCTVFRNRIYNDANIDPAFATLRQRNCPQTGGDGNFAPLDIGSPVVFNNNYYQNLLIRRGLLHSDQELFNNGTQDTLVRTYSSNDASFRSDFAAAMVKMGAITPLTGANGEIRRNCRRLN*

Retrieve as FASTA  
Remarks Complete sequence from genomic.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTTCTTTTACTAGTTGTTTTGTTACATTCTCTATGGTTTTTCTTTTACTTGCATGTTCTAGTACTACTCATGCACAACTTTCTGCTACCTTTTATGCTACAAGTTGTCCAAATTTG
CAAACTATTGTTAACACTGCCATGACTCAAGCAGTTAATAATCAACAAAGAATGGGTGCTTCGATTCTTCGTTTGTTCTTTCACGATTGTTTCGTTCAG
GTTTGGCCTCACTGTTGATCT
TTACTTTCACATTTCTGCATTTTGTTTCTCTCTTTTTAAGCAGTCTTTAATAATAATCTGTGTTGGATGATTGCTGCAGGGTTGTGATGCATCGATCTTATTAGATGATACAGCGACATT
CACTGGAGAGAAGAATGCAGGACCAAACGCAAACTCCGTTCGTGGATTTGAAGTGATTGATACCATTAAAACTCGTGTGGAAGCTGCTTGCAATGCAACAGTTTCTTGTGCAGATATCTT
AGCATTGGCAGCAAGAGATGGAACTGTTGCG
GTAAGTGCTTGGAGAATTATTTAGTATACATTGACATTGATATCCTATTACAGAACATAAAATGATATAAGCCCAATAATATTAGGATT
TTTCGTTCAATTTATCATGTCATAGTAACGGTTGCTTGCAGCTTGGAGGACCAACATGGACCGTTGCACTTGGTCGTCGTGATTCAAGAACAGCTAGCCAGAGTGCAGCCAACAGCCAAA
TCCCTTCTCCAGCAGCCAGTCTTGCTACTCTTACATCTTCATTCTCTGCCAAAGGACTTAATGCACGTGACCTTACCGCACTTTCTGGTGCTCACACCATAGGTCAAGCACGGTGCACAG
TATTCAGAAACCGTATATACAATGATGCTAATATTGATCCAGCCTTCGCTACATTGCGACAAAGAAACTGCCCACAGACTGGTGGAGATGGCAACTTCGCCCCACTCGACATAGGAAGCC
CAGTTGTATTCAACAACAACTATTATCAGAATCTATTGATTAGACGTGGACTGCTTCATTCTGACCAAGAACTCTTCAACAATGGTACTCAAGACACTTTAGTACGAACTTATAGTTCTA
ATGATGCTTCTTTCCGAAGTGATTTTGCTGCTGCCATGGTCAAAATGGGTGCTATTACTCCACTTACTGGAGCAAATGGTGAGATTAGAAGAAACTGCAGGAGATTGAACTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTTCTTTTACTAGTTGTTTTGTTACATTCTCTATGGTTTTTCTTTTACTTGCATGTTCTAGTACTACTCATGCACAACTTTCTGCTACCTTTTATGCTACAAGTTGTCCAAATTTG
CAAACTATTGTTAACACTGCCATGACTCAAGCAGTTAATAATCAACAAAGAATGGGTGCTTCGATTCTTCGTTTGTTCTTTCACGATTGTTTCGTTCAG
GGTTGTGATGCATCGATCTTA
TTAGATGATACAGCGACATTCACTGGAGAGAAGAATGCAGGACCAAACGCAAACTCCGTTCGTGGATTTGAAGTGATTGATACCATTAAAACTCGTGTGGAAGCTGCTTGCAATGCAACA
GTTTCTTGTGCAGATATCTTAGCATTGGCAGCAAGAGATGGAACTGTTGCG
CTTGGAGGACCAACATGGACCGTTGCACTTGGTCGTCGTGATTCAAGAACAGCTAGCCAGAGTGCAGCC
AACAGCCAAATCCCTTCTCCAGCAGCCAGTCTTGCTACTCTTACATCTTCATTCTCTGCCAAAGGACTTAATGCACGTGACCTTACCGCACTTTCTGGTGCTCACACCATAGGTCAAGCA
CGGTGCACAGTATTCAGAAACCGTATATACAATGATGCTAATATTGATCCAGCCTTCGCTACATTGCGACAAAGAAACTGCCCACAGACTGGTGGAGATGGCAACTTCGCCCCACTCGAC
ATAGGAAGCCCAGTTGTATTCAACAACAACTATTATCAGAATCTATTGATTAGACGTGGACTGCTTCATTCTGACCAAGAACTCTTCAACAATGGTACTCAAGACACTTTAGTACGAACT
TATAGTTCTAATGATGCTTCTTTCCGAAGTGATTTTGCTGCTGCCATGGTCAAAATGGGTGCTATTACTCCACTTACTGGAGCAAATGGTGAGATTAGAAGAAACTGCAGGAGATTGAAC
TGA

Retrieve as FASTA