Entry information : AcoPrx72 (AcoGoldSmith_v1.020115m)
Entry ID 8619
Creation 2011-07-03 (Qiang Li)
Last sequence changes 2011-12-13 (Qiang Li)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2011-12-14 (Qiang Li)
Peroxidase information: AcoPrx72 (AcoGoldSmith_v1.020115m)
Name (synonym) AcoPrx72 (AcoGoldSmith_v1.020115m)
Class Class III peroxidase    [Orthogroup: Prx134]
Taxonomy Eukaryota Viridiplantae Streptophyta Ranunculaceae Aquilegia
Organism Aquilegia coerulea     [TaxId: 218851 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value AcoPrx72
start..stop
S start..stop
AcoPrx106 596 0 1..319 1..319
AcoPrx65 590 0 1..319 1..315
AcoPrx94 586 0 1..308 1..307
AcoPrx[P]81 565 0 1..319 1..317
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 2574426..2574650 225 N° 2 2574136..2574315 180 N° 3 2573474..2574025 552  
complement(join(2573474..2574025,2574136..2574315,2574426..2574650))


exon

Literature and cross-references AcoPrx72 (AcoGoldSmith_v1.020115m)
DNA ref. Phytozome 12:   scaffold_3 (2574650..2573474)
Protein sequence: AcoPrx72 (AcoGoldSmith_v1.020115m)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   319 (291)
PWM (Da):   %s   33918.89 (31157.4) Transmb domain:   %s   i7-29o
PI (pH):   %s   8.57 (8.57) Peptide Signal:   %s   cut: 29 range:29-319
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MASSTSSVLSIGLVMVLLTTFSLPAALAQLSVSYYASTCPSVFDTVRSATRSVINRDGRMGASILRLFFHDCFVSGCDGGILLSGGERNAPGNIAMVRGYDVIDSIKAQVDRACGRSVVSCADILAISSRDSIVELGGPSYSVPLGRRDTRTPNIAGARSDLPAFFHDLPRIIDIFQRKGFSEREMVALSGAHSIGQAQCSSFRDRIYSNTSNIDPAFAVSRQATCPRSGGDGNLAPLDPQSPGRFGNNYFQALMNRRGLLNSDQVLFNGGSTDSIVRTYANAASAFSTDFMNAMVKMGNLSPLTGTQGEIRTTCQRVN

Retrieve as FASTA  
Remarks Complete sequence from genomic.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTAGCAGTACTAGTTCAGTTCTCTCAATAGGTCTTGTTATGGTCCTTTTAACCACCTTTTCCTTACCAGCTGCTTTAGCACAGCTTTCAGTCTCCTACTATGCCAGTACATGCCCA
TCAGTTTTTGATACTGTTCGGTCAGCCACACGGTCTGTCATCAATAGAGATGGTCGAATGGGTGCTTCCATTTTACGTCTATTTTTTCATGATTGTTTTGTTAGT
GTAAGTTCATTTTCT
TACTCAAAATGGTTTATATTGTCGTCTTAATTATATATAATTATGTTAAGTAGTATTTATGATCTAATTAAGGTGCATTGCTTTCATGGCTTCAGGGTTGTGATGGAGGAATTCTATTGT
CTGGCGGTGAAAGAAATGCCCCAGGCAATATTGCTATGGTAAGAGGGTATGATGTTATTGATAGCATAAAGGCACAGGTTGATAGAGCATGTGGGCGTAGTGTAGTTTCATGTGCAGACA
TCCTAGCCATTAGTAGCCGAGACTCCATTGTTGAA
GTAAGTAAACTAACTGGCGTTGATTGAATGAATTTAGATAATGAAATTCAAAAACATAATTGTATTCCCATATATATTAGTTATA
ACCAAAATTTCATTTTGTATCTCAGCTTGGAGGACCAAGTTATTCAGTTCCACTAGGAAGGAGAGATACAAGAACTCCAAACATTGCAGGAGCAAGAAGCGATCTCCCCGCCTTCTTTCA
CGATCTTCCAAGGATCATAGACATATTTCAACGTAAAGGCTTTAGTGAACGAGAAATGGTAGCTTTATCTGGAGCACACTCAATAGGCCAAGCCCAATGCTCTTCTTTTAGAGATCGAAT
CTATAGTAATACTAGCAACATCGATCCCGCATTCGCAGTGTCTAGGCAGGCTACTTGTCCTCGTAGTGGTGGAGATGGCAACTTAGCACCACTAGACCCTCAAAGCCCAGGTCGTTTTGG
AAACAATTATTTCCAGGCATTGATGAACAGAAGAGGACTTCTTAACTCTGATCAGGTGTTGTTTAACGGTGGCTCGACCGATTCTATTGTAAGGACATATGCCAATGCTGCTAGTGCCTT
TTCAACAGATTTCATGAATGCAATGGTTAAAATGGGGAACTTAAGTCCCTTAACTGGTACTCAAGGCGAGATACGCACAACTTGTCAAAGGGTAAAT

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTAGCAGTACTAGTTCAGTTCTCTCAATAGGTCTTGTTATGGTCCTTTTAACCACCTTTTCCTTACCAGCTGCTTTAGCACAGCTTTCAGTCTCCTACTATGCCAGTACATGCCCA
TCAGTTTTTGATACTGTTCGGTCAGCCACACGGTCTGTCATCAATAGAGATGGTCGAATGGGTGCTTCCATTTTACGTCTATTTTTTCATGATTGTTTTGTTAGT
GGTTGTGATGGAGGA
ATTCTATTGTCTGGCGGTGAAAGAAATGCCCCAGGCAATATTGCTATGGTAAGAGGGTATGATGTTATTGATAGCATAAAGGCACAGGTTGATAGAGCATGTGGGCGTAGTGTAGTTTCA
TGTGCAGACATCCTAGCCATTAGTAGCCGAGACTCCATTGTTGAA
CTTGGAGGACCAAGTTATTCAGTTCCACTAGGAAGGAGAGATACAAGAACTCCAAACATTGCAGGAGCAAGAAGC
GATCTCCCCGCCTTCTTTCACGATCTTCCAAGGATCATAGACATATTTCAACGTAAAGGCTTTAGTGAACGAGAAATGGTAGCTTTATCTGGAGCACACTCAATAGGCCAAGCCCAATGC
TCTTCTTTTAGAGATCGAATCTATAGTAATACTAGCAACATCGATCCCGCATTCGCAGTGTCTAGGCAGGCTACTTGTCCTCGTAGTGGTGGAGATGGCAACTTAGCACCACTAGACCCT
CAAAGCCCAGGTCGTTTTGGAAACAATTATTTCCAGGCATTGATGAACAGAAGAGGACTTCTTAACTCTGATCAGGTGTTGTTTAACGGTGGCTCGACCGATTCTATTGTAAGGACATAT
GCCAATGCTGCTAGTGCCTTTTCAACAGATTTCATGAATGCAATGGTTAAAATGGGGAACTTAAGTCCCTTAACTGGTACTCAAGGCGAGATACGCACAACTTGTCAAAGGGTAAAT

Retrieve as FASTA