Entry information : SbKat03 (Sobic.010G274500.1 [2.1] / Sb10g030840 [1.4])
Entry ID 862
Creation 2008-10-23 (Christophe Dunand)
Last sequence changes 2008-10-23 (Christophe Dunand)
Sequence status complete
Reviewer Messaoudi
Last annotation changes 2014-08-06 (Messaoudi)
Peroxidase information: SbKat03 (Sobic.010G274500.1 [2.1] / Sb10g030840 [1.4])
Name (synonym) SbKat03 (Sobic.010G274500.1 [2.1] / Sb10g030840 [1.4])
Class Catalase    [Orthogroup: Kat001]
Taxonomy Eukaryota Viridiplantae Streptophyta Monocotyledons Poaceae Sorghum
Organism Sorghum bicolor    [TaxId: 4558 ]
Cellular localisation N/D
Tissue type Pannicles
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value SbKat03
start..stop
S start..stop
ZmKat1 1012 0 1..492 1..492
OsKat02 987 0 1..492 1..492
VvKat02 909 0 1..492 1..492
ZaKat01 905 0 1..492 1..492
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 60510522..60510536 15 N° 2 60510684..60510780 97 N° 3 60511719..60511996 278 N° 4 60512654..60513430 777
N° 5 60513562..60513651 90 N° 6 60513817..60513884 68 N° 7 60513980..60514073 94 N° 8 60514206..60514265 60
join(60510522..60510536,60510684..60510780,60511719..60511996,60512654..60513430 ,60513562..60513651,60513817..60513884,60513980..60514073,60514206..60514265)


exon

Literature and cross-references SbKat03 (Sobic.010G274500.1 [2.1] / Sb10g030840 [1.4])
Literature Klein,R.R. et al., unpublished
DNA ref. Phytozome 12:   chromosome_10 (60510522..60514265)
Cluster/Prediction ref. UniGene:   Sbi.4044
Protein sequence: SbKat03 (Sobic.010G274500.1 [2.1] / Sb10g030840 [1.4])
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   492
PWM (Da):   %s   56674.14  
PI (pH):   %s   7.11
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MDPYKHRPSSGSNSSFWTTNSGAPVWNNNSALTVGQRGPILLEDYHLIEKLAQFDRERIPERVVHARGASAKGFFEVTHDISHLTCADFLRAPGVQTPVIVRFSTVVHERGSPETLRDPRGFAVKFYTRGNFDLVGNNMPVFFIRDGMKFPDMVHAFKPNPKTNLQENWRIVDFFSHHPESLHMFTFLFDDVGIPLNYRHMEGFGVNTYTLINRDGKPHLVKFHWKPTCGVKCLLDDEAVTVGGTCHSHATKDLYDSIAAGNYPEWKLYIQTIDLDHEDKFDFDPLDVTKTWPEDIIPLQPVGRMVLNKNIDNFFAENEQIAFCPAIIVPGIHYSDDKLLQTRIFSYADTQRHRLGPNYLMLPVNAPKCAHHNNHHEGFMNFMHRDEEVNYFPSRFDPTRHAEKVPIPSRVLTGCREKCIIEKENNFKQAGERFRSFDPARQDRFIQRWVDALSDPRVTHEHHTIWINYWSCDASLGQKLASRLNLKPNM*

Retrieve as FASTA  
Remarks Complete sequence from genomic (chromo 10, 7 introns) and 110 ESTs
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGATCCGTACAAGGTACTGTTTTGTTTTTCGATTTCGACTTCTTTCTTCATCGATTTTGCCCTATGTATTAGATCCTCAAAATCAATTTCGAATCTTGTTTCCTTCCGCCCTTGATTG
ATGCGCTCGCTCATCTGATTTGTGAGATTCTTCTTCTTGCAGCACCGCCCTTCTAGCGGGAGCAACTCCAGCTTCTGGACCACCAACTCCGGCGCCCCCGTCTGGAACAACAACTCCGCC
CTTACCGTCGGACAGCGAG
GTCAGACTCTGCTCTGCTGCCTCCATTACTCCTTTCCTTTTTACCTTACACGATCCTGTAGCATATATGTTCTTGATTTGTGTGAGATTCATTCGATACGT
GATCTGTGCTAGCCTTGCCATGTGGAATTAGTCGTTCTTTTGGTTGCTAGCTGCTCTGATCCCTCTACCAGTAGTATTGCACTGTGGAAGCTTGGCTGTAGCTGTTGACCTGAGGATTTG
GCTTCCAATTCGTTCAAAGCTTGCGGCTTGATGTGCTTTTGGTTGATTTCCAGTGAATAATTTTGCTGCTCTATATATACGGATTGATTCACCTGTCATATAATTTCGTCGATGAATTTG
AGACTTGCTTATTCTTCCTGTGCTGCCCAAAGGTCTTATTCCTTGGATCAGCTGTAAGGTGAAACTTTTGTCCTGATATTTTCGTCAGTCGCTGTCGTACCATTAAGTTGCTTAAGGGAA
AGGGAAAGAAAGCACCTTTCCAATACGAAATGCCATCATGGAGTTATAGTGATAATCTTAGGTGAGGGGCAATTGCAGGGTGGTAAAGTCAAGGCAGGGTAATCACAGTTGATTATTACT
GGTGCGCAGTGTGGTATATTTACTTTTGACAGTTACCTGGGCTAGTGCTGAATCACTACCAGAAAGCATAACCTTTGGATTTTCTCTCCTCAGCATGTATGGCAAAACTTTGAAAGTGAT
TGCAAGTCCAGTTTGGTTCTTCTGAATGTCATTGTCGCAAAAAGTGTCCATCAATTACAGGAACAGGATACAGCACACCTATCTGTAACCAATATGTTTCTTTCGGTGATGTCAGAAAAA
TAATAAGCCTTTTGTTTTAGGAGTTTGCTTTATTGTCTACCTGCTTCACTTTCTGTTTTGGTGTTTAGCTAACAATTTCTGATTTATTGTTTCACACGATGTGTTCTTCTTTGGCAGGAC
CCATCCTCCTTGAGGATTATCATCTAATCGAAAAGCTTGCTCAGTTCGACAGGGAACGTATCCCTGAACGTGTTGTGCATGCACGGGGAGCCAGTGCCAAGGGTTTCTTTGAGGTCACTC
ATGATATCTCTCACCTTACATGTGCTGATTTTCTCCGGGCTCCTGGGGTCCAGACACCTGTTATTGTCCGGTTCTCTACAGTTGTGCATGAGCGTGGAAGCCCCGAGACCTTGAGGGATC
CACGTGGTTTTGCTGTCAAGTTCTACACCAGAGAG
GTACTGAGGATAAATTCTAACTTGCCTCCTAGGGGGAATATATATACATCTTAACTGTTCTATTTTTTGTTATGTCTTAAAAAGG
AACATTCTTTTTAGAACTGTTGTGAGATGACACATCTTGGCAACATTTTTCTGTCAATGTAAAGGTTTAGCTGATTTCAACTATTGCTTGGTAACTTGATGTGTACTTTAGCCATGTAGA
TGATGTCCTTGGCATGAGCTGTTATTCAGATGAACTGATAGCTCTATATTCTTTTACTCATTGGAATGAACTGTATCTTTTTTTTTCCTTAGTTGAAAGCTACCTCCTGTTTAAGTTGAC
CTTTTACATTGTCATGATGAACTTTTATGAAATTAAATTCTGATTACCTATTTGTGACACAGATACAAGTGTCTTTTGCTTAAAAGAACAATACAATGTGGCTCCATAATGTGCACATGG
ATAATCACAGATTCTCTCAGCAGAAACAGTAAAATCAAAGATATTTCATAACTGAGTCCATCTCTGTCCAGTTTCACCTACAGATTGCTGTGCTGTTTGTTTACCTTTTTTTAACAATTT
TTGACGCCTTATATAGTGACCCCGACACTTTATATTGAGCTTTTTATATCCAAAGGAATAGTATCTTATGATTTTCTCCGTGCCTTTTTCAGGGTAACTTTGACCTTGTGGGTAACAACA
TGCCTGTGTTTTTCATACGAGATGGGATGAAATTCCCTGATATGGTCCATGCTTTCAAGCCAAACCCAAAGACCAATTTGCAGGAGAACTGGAGAATAGTAGATTTCTTCTCTCACCACC
CAGAGAGCCTGCACATGTTCACCTTCCTCTTTGATGATGTTGGCATCCCACTCAACTACAGGCACATGGAGGGCTTTGGTGTCAATACCTACACCTTGATCAACAGGGATGGAAAGCCTC
ACCTTGTGAAATTCCATTGGAAGCCTACTTGTGGCGTGAAATGCTTGCTTGATGATGAAGCTGTGACTGTTGGAGGTACCTGCCATAGCCATGCGACAAAGGATCTATATGATTCCATTG
CAGCTGGGAATTACCCTGAATGGAAGCTCTACATCCAGACTATCGATCTTGACCATGAGGATAAGTTTGACTTCGACCCGCTTGATGTCACCAAGACCTGGCCTGAGGATATCATCCCAC
TGCAACCTGTTGGACGGATGGTCCTGAACAAGAACATTGATAACTTCTTTGCGGAGAATGAACAAATTGCTTTCTGCCCAGCGATTATTGTCCCTGGAATCCACTATTCTGATGATAAGC
TGCTCCAGACGAGAATCTTCTCCTATGCTGATACCCAGAGGCACCGCCTTGGTCCAAACTATCTGATGCTTCCTGTGAATGCACCAAAATGTGCCCACCACAACAACCACCATGAAGGGT
TCATGAACTTCATGCACAGGGATGAAGAG
GTACTATGTTCTTTGGACTTCTTTCTCCTTTTGCATGCAAGTGTGTTAGGATGCATCTTACCTATTGACACATGTAACATGTGGGAGTTCT
TCCTTTATAGCACTTATATCTATTTTCTCTGCTTCTTTAGGTGAACTACTTCCCTTCAAGGTTTGATCCTACCCGTCATGCTGAGAAGGTCCCTATTCCTTCCCGTGTTCTAACAGGCTG
CCGCGAGAAG
GTGTGTATTGTAGTATGTTTAAATTCGAACAGTGCCTTTATGTTAACAATATTATGCTATGGTGGGCTTGTGGCTGCATCGTTGTACTATATAATGGCGAAGGTGAGTCA
TTGTTGGATTTTTTTCTTGATTCTGAGAACCTGGCGTGTGCTGTTGAATCTGCAGTGCATCATCGAGAAGGAGAACAACTTCAAGCAGGCTGGTGAGAGATTTCGATCCTTTGACCCTGC
CAG
GTTTGCTCCCACACCTCAGGCTGTTTGGTTTACAGGCATAGAAAGACATTAAGCTGCTGTTTGCCTAATTCAAGTGTTTTGGTATCTGATGACAGGCAAGACCGGTTTATCCAACGA
TGGGTTGACGCACTGTCAGACCCTCGTGTTACCCATGAACACCATACGATTTGGATCAACTACTGGTCTCAG
GTATTCATTTTGTTGTTTGTTTTTGGTAAAATGCTCAGTGGCTACTTG
GGCTATTGCTAACCATGTACAACAGCTGCGGACATTTGTGTTTTATTATCTTGGTACTGAAACCATATTACCTGTGTGCTGCAGTGTGATGCCTCTCTTGGCCAGAAGCTGGCTTCTAGG
CTGAACCTGAAGCCGAACATGTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGATCCGTACAAGCACCGCCCTTCTAGCGGGAGCAACTCCAGCTTCTGGACCACCAACTCCGGCGCCCCCGTCTGGAACAACAACTCCGCCCTTACCGTCGGACAGCGAGGACCCATC
CTCCTTGAGGATTATCATCTAATCGAAAAGCTTGCTCAGTTCGACAGGGAACGTATCCCTGAACGTGTTGTGCATGCACGGGGAGCCAGTGCCAAGGGTTTCTTTGAGGTCACTCATGAT
ATCTCTCACCTTACATGTGCTGATTTTCTCCGGGCTCCTGGGGTCCAGACACCTGTTATTGTCCGGTTCTCTACAGTTGTGCATGAGCGTGGAAGCCCCGAGACCTTGAGGGATCCACGT
GGTTTTGCTGTCAAGTTCTACACCAGAGAG
GGTAACTTTGACCTTGTGGGTAACAACATGCCTGTGTTTTTCATACGAGATGGGATGAAATTCCCTGATATGGTCCATGCTTTCAAGCCA
AACCCAAAGACCAATTTGCAGGAGAACTGGAGAATAGTAGATTTCTTCTCTCACCACCCAGAGAGCCTGCACATGTTCACCTTCCTCTTTGATGATGTTGGCATCCCACTCAACTACAGG
CACATGGAGGGCTTTGGTGTCAATACCTACACCTTGATCAACAGGGATGGAAAGCCTCACCTTGTGAAATTCCATTGGAAGCCTACTTGTGGCGTGAAATGCTTGCTTGATGATGAAGCT
GTGACTGTTGGAGGTACCTGCCATAGCCATGCGACAAAGGATCTATATGATTCCATTGCAGCTGGGAATTACCCTGAATGGAAGCTCTACATCCAGACTATCGATCTTGACCATGAGGAT
AAGTTTGACTTCGACCCGCTTGATGTCACCAAGACCTGGCCTGAGGATATCATCCCACTGCAACCTGTTGGACGGATGGTCCTGAACAAGAACATTGATAACTTCTTTGCGGAGAATGAA
CAAATTGCTTTCTGCCCAGCGATTATTGTCCCTGGAATCCACTATTCTGATGATAAGCTGCTCCAGACGAGAATCTTCTCCTATGCTGATACCCAGAGGCACCGCCTTGGTCCAAACTAT
CTGATGCTTCCTGTGAATGCACCAAAATGTGCCCACCACAACAACCACCATGAAGGGTTCATGAACTTCATGCACAGGGATGAAGAG
GTGAACTACTTCCCTTCAAGGTTTGATCCTACC
CGTCATGCTGAGAAGGTCCCTATTCCTTCCCGTGTTCTAACAGGCTGCCGCGAGAAG
TGCATCATCGAGAAGGAGAACAACTTCAAGCAGGCTGGTGAGAGATTTCGATCCTTTGACCCT
GCCAG
GCAAGACCGGTTTATCCAACGATGGGTTGACGCACTGTCAGACCCTCGTGTTACCCATGAACACCATACGATTTGGATCAACTACTGGTCTCAGTGTGATGCCTCTCTTGGCCAG
AAGCTGGCTTCTAGGCTGAACCTGAAGCCGAACATGTAA

Retrieve as FASTA