Entry information : AcoPrx73 (AcoGoldSmith_v1.020558m[1.0] / Aquca_030_00303[1.1])
Entry ID 8620
Creation 2011-07-03 (Qiang Li)
Last sequence changes 2011-12-07 (Qiang Li)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2015-10-15 (Christophe Dunand)
Peroxidase information: AcoPrx73 (AcoGoldSmith_v1.020558m[1.0] / Aquca_030_00303[1.1])
Name (synonym) AcoPrx73 (AcoGoldSmith_v1.020558m[1.0] / Aquca_030_00303[1.1])
Class Class III peroxidase    [Orthogroup: Prx038]
Taxonomy Eukaryota Viridiplantae Streptophyta Ranunculaceae Aquilegia
Organism Aquilegia coerulea     [TaxId: 218851 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value AcoPrx73
start..stop
S start..stop
PpePrx71 456 6e-163 10..318 41..349
LjPrx50 446 1e-158 23..318 53..348
GmPrx64 443 1e-157 23..318 45..340
EgrPrx94 437 1e-155 7..319 10..325
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 2242947..2243159 213 N° 2 2242509..2242851 343 N° 3 2242019..2242419 401  
complement(join(2242019..2242419,2242509..2242851,2242947..2243159))


exon

Literature and cross-references AcoPrx73 (AcoGoldSmith_v1.020558m[1.0] / Aquca_030_00303[1.1])
DNA ref. Phytozome 12:   scaffold_30 (2243159..2242019)
Protein sequence: AcoPrx73 (AcoGoldSmith_v1.020558m[1.0] / Aquca_030_00303[1.1])
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   319 (297)
PWM (Da):   %s   35893.46 (33496.0)  
PI (pH):   %s   8.87 (8.60) Peptide Signal:   %s   cut: 23 range:23-319
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MKYTLGLLLVLQVITISVQVKGEDYLSTDYYHTSCPQLEEIIHKKVVAWVNKDYTIAASIIRLHFHDCAVRGCDASILLNHYGSERSSAVSKSLRGFELIDDIKAEVERKCPKTVSCADILTATARDATLQIGGPFWQVPYGRKDGRVSLAKEANLVPAGRENITSLIEFCQSRGMNLLDLVVLSGAHTIGRSTCEPVQERLYRFNGTKQADPSINKMYLNYLKRKCRWASEFVNLDARTPYTFDATYYKNLQKKMGLLSTDQLLYSDSRTKPLVTALANQPWLFFQQFAVSMIKLGNTQVLTGKYEGEIRNNCNFVN

Retrieve as FASTA  
Remarks Complete sequence from genomic (3 introns). Incorrect prediction from phytozome (5' end is missing).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAAGTACACTCTTGGCCTTCTTTTAGTTCTTCAAGTCATTACAATTTCAGTTCAAGTAAAGGGCGAGGACTATCTTTCAACCGATTACTATCATACAAGTTGTCCTCAGCTTGAAGAA
ATTATCCACAAGAAGGTAGTTGCTTGGGTCAACAAGGATTACACAATAGCAGCCAGTATCATCAGGTTGCACTTCCATGATTGTGCAGTCAGG
GTAAGGATATTAATTGTCGCAGTTAAG
ATTATCTTCATTAACTGTTATTTGCTATTTTTTCTCATTGTTAGCATATGCCTCTTTTTCCTTGTCAGGGATGTGATGCTTCTATTTTACTAAACCACTATGGTAGTGAAAGAAGTTCTG
CTGTCAGCAAATCATTAAGAGGATTTGAATTGATCGACGATATTAAAGCAGAAGTTGAGCGGAAATGTCCCAAGACTGTCTCATGTGCCGACATTCTCACTGCTACGGCTAGAGATGCCA
CACTTCAAATTGGAGGGCCTTTCTGGCAAGTACCATATGGTAGAAAAGATGGCCGAGTATCTCTTGCAAAGGAAGCTAATCTTGTCCCAGCAGGCCGCGAAAACATAACAAGTTTGATTG
AGTTTTGTCAGTCTAGAGGCATGAATTTACTTGACTTGGTTGTCCTTTCAG
GTAAATATTAAGGATACCATCTCAATCCATGGCTTGTTATAGTCTCCTTTCATTTTATGTTGTGTTTAC
TAATATGGTCTTTATATCAGGAGCACATACCATTGGGCGTAGTACGTGTGAACCCGTTCAAGAGAGGCTATATAGATTCAATGGAACAAAACAAGCTGATCCCTCCATCAATAAAATGTA
CTTGAATTACTTGAAGAGAAAATGTAGATGGGCATCAGAATTTGTAAACCTGGATGCAAGAACCCCTTATACCTTCGACGCAACCTATTACAAAAATCTTCAAAAGAAGATGGGATTGCT
TTCAACTGATCAATTGCTTTACTCTGACTCAAGGACAAAACCACTAGTTACAGCTTTAGCAAATCAACCATGGCTGTTCTTCCAACAGTTTGCAGTTTCCATGATCAAGCTAGGAAACAC
TCAAGTTCTTACTGGTAAATATGAAGGAGAGATCCGAAACAACTGCAATTTTGTTAATCGT

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAAGTACACTCTTGGCCTTCTTTTAGTTCTTCAAGTCATTACAATTTCAGTTCAAGTAAAGGGCGAGGACTATCTTTCAACCGATTACTATCATACAAGTTGTCCTCAGCTTGAAGAA
ATTATCCACAAGAAGGTAGTTGCTTGGGTCAACAAGGATTACACAATAGCAGCCAGTATCATCAGGTTGCACTTCCATGATTGTGCAGTCAGG
GGATGTGATGCTTCTATTTTACTAAAC
CACTATGGTAGTGAAAGAAGTTCTGCTGTCAGCAAATCATTAAGAGGATTTGAATTGATCGACGATATTAAAGCAGAAGTTGAGCGGAAATGTCCCAAGACTGTCTCATGTGCCGACATT
CTCACTGCTACGGCTAGAGATGCCACACTTCAAATTGGAGGGCCTTTCTGGCAAGTACCATATGGTAGAAAAGATGGCCGAGTATCTCTTGCAAAGGAAGCTAATCTTGTCCCAGCAGGC
CGCGAAAACATAACAAGTTTGATTGAGTTTTGTCAGTCTAGAGGCATGAATTTACTTGACTTGGTTGTCCTTTCAG
GAGCACATACCATTGGGCGTAGTACGTGTGAACCCGTTCAAGAG
AGGCTATATAGATTCAATGGAACAAAACAAGCTGATCCCTCCATCAATAAAATGTACTTGAATTACTTGAAGAGAAAATGTAGATGGGCATCAGAATTTGTAAACCTGGATGCAAGAACC
CCTTATACCTTCGACGCAACCTATTACAAAAATCTTCAAAAGAAGATGGGATTGCTTTCAACTGATCAATTGCTTTACTCTGACTCAAGGACAAAACCACTAGTTACAGCTTTAGCAAAT
CAACCATGGCTGTTCTTCCAACAGTTTGCAGTTTCCATGATCAAGCTAGGAAACACTCAAGTTCTTACTGGTAAATATGAAGGAGAGATCCGAAACAACTGCAATTTTGTTAATCGT

Retrieve as FASTA