Entry information : AcoPrx76 (AcoGoldSmith_v1.021830m)
Entry ID 8623
Creation 2011-07-03 (Qiang Li)
Last sequence changes 2011-10-03 (Qiang Li)
Sequence status partial
Reviewer Qiang Li
Last annotation changes 2011-12-14 (Qiang Li)
Peroxidase information: AcoPrx76 (AcoGoldSmith_v1.021830m)
Name (synonym) AcoPrx76 (AcoGoldSmith_v1.021830m)
Class Class III peroxidase     [Orthogroup: Prx029]*
Taxonomy Eukaryota Viridiplantae Streptophyta Ranunculaceae Aquilegia
Organism Aquilegia coerulea     [TaxId: 218851 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value AcoPrx76
start..stop
S start..stop
AcoPrx[P]59 419 3e-150 66..301 1..218
AcoPrx16 309 2e-105 25..301 44..341
AfpPrx05 309 3e-105 25..301 44..341
CsPrx45 286 2e-96 16..301 21..324
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 539964..540167 204 N° 2 539301..539492 192 N° 3 538300..538806 507  
complement(join(538300..538806,539301..539492,539964..540167))


exon

Literature and cross-references AcoPrx76 (AcoGoldSmith_v1.021830m)
DNA ref. Phytozome 12:   scaffold_49 (540167..538300)
Protein sequence: AcoPrx76 (AcoGoldSmith_v1.021830m)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   301 (282)
PWM (Da):   %s   32906.27 (30785.3)  
PI (pH):   %s   6.3 (6.30) Peptide Signal:   %s   cut: 20 range:20-301
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MSSPMYFFCCLMVLVLGQANSMLSVDFYHTSCREAESIITSAMSQAFKRDPTLAASLLRLHFHDCFVQGCDASVLLDYTEHHAGEKTALPNDQSLRGFEVIDTIKAELEKACPHTVSCSDVIAAVARDSVVLSGGPRWSVEFGRRDSITVANNVTVLQGLPSPNSELADLLAKFEQIGMNLRDIVALSGGHTIGSARCFFLKGQRPNSCSRNETHASLDQTPKVFDNNYYLALLRKNMNGGFFQSDNALVKFTPALDLVQIYATNSTAFFDDFATSMLKMGRIAPLLGSEGEVRINCRMVN

Retrieve as FASTA  
Remarks Complete sequence from genomic. Incorrect prediction from phytozome (3' end is missing).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTCTTCACCAATGTATTTCTTCTGTTGCTTAATGGTACTGGTTCTTGGTCAGGCCAACTCCATGTTAAGTGTAGACTTCTACCATACTTCATGCCGAGAAGCTGAATCAATCATAACG
TCTGCAATGTCTCAAGCTTTTAAGCGAGATCCAACCCTGGCAGCATCGCTTTTACGGTTGCATTTCCATGATTGTTTTGTTCAG
GTTAGCATAAATATTATCCTAAGTTTTTAAGTTATG
ATTTGAAATATTTCATCTCAAGTGTTTTGTAAAGGTATGTCCATGACTTCATTCTGCTTGCTCAGAGGTTCTTGCGTGACTGATCTGTTACCTGCAACTGTGAAACTCCCTTAGGGAATC
ACAATATAGCACCTCTGATCAGAAGTTAATTGGTTTCATTTTGGTGTGATTTCTGCATTCAATGTTTATAGTATGTGTATTTAATTTATTCGGTAAATAGATCATTAAGCTGGTCGTTTA
CGAGGCCATTGTTGGTTGCAATACTTCTTTATTCCTATTTGTCATGTGCAACATATAAAATGAATTGCTCTGACTAATCATAATAGAAAATTGTTTATCATTCCTCCTTAAACTAGTTAT
ACTTTCATTGTGCAGATCGAGTTTATGTGAAATAACAATGGGATTATATTTGTTCTAATAACTTGGTTTTCGCAGGGCTGTGATGCATCTGTTCTTTTGGATTATACAGAACACCATGCC
GGGGAAAAGACAGCACTGCCTAACGATCAATCCCTCCGAGGATTTGAGGTCATAGACACCATCAAGGCTGAACTAGAAAAGGCTTGCCCTCACACAGTTTCATGCTCGGATGTCATTGCA
GCAGTAGCAAGGGACTCTGTGGTTCTG
GTATTGCCTTTTCTGATACTTCCTTGTTAAATTGTTATTTTCCTAGTGTTTAAAATTATTTTGTCAAGGAATAGCTGATTACTGGTCTGGTAG
TATGTCGTCTTTTCCCCAACCTGCATTGATTTAAATTCTCATGTGCACCCTGCCTCCACATCATATCTAATTAAAACACAAAGGAGCCGAGGAATAAATACAGACAAGCTATTGTTTTTT
GGACTGGGTAGTCTTTGTATTTGGTTTGTTTGTAATTATTGTTTATCTAGCCAATGTTGAGTACTGAACTACTGATGAATACCTCTATTACTAATTACTGGCTCACAATTGTTCTGTAAC
GTTGATGTATATTTCACTTTGTTAATAACATGCCAATTACTAATAATTTGTATCTAAGTTCAGAATGGATATATATGGACAGTTCATCACCATATCTAAACATTGAAATTAGACGATATA
CGGCATGTAGTTAACAATTGTGTTTTGGTCTGTATATGTAGTCAGGAGGACCTAGATGGAGCGTTGAGTTCGGCAGGAGAGATAGCATTACTGTGGCAAATAATGTTACTGTCCTTCAGG
GACTTCCAAGTCCAAATTCTGAGCTTGCAGATCTGTTGGCAAAATTTGAGCAAATAGGTATGAACCTTAGAGATATAGTAGCTCTCTCAGGGGGGCATACCATAGGCTCTGCAAGGTGTT
TTTTTCTGAAAGGGCAACGACCAAACAGTTGCTCCAGGAATGAAACACATGCTTCTCTGGATCAAACACCCAAGGTTTTTGACAATAACTATTATCTTGCTCTCCTCCGAAAGAATATGA
ATGGGGGGTTTTTTCAGTCAGACAATGCCCTTGTGAAGTTTACTCCTGCACTTGACCTTGTTCAGATTTATGCAACGAATTCAACTGCATTCTTTGATGATTTCGCCACATCAATGCTAA
AAATGGGAAGAATTGCTCCTCTTCTAGGTTCTGAAGGTGAAGTACGCATCAACTGTCGTATGGTGAAT

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTCTTCACCAATGTATTTCTTCTGTTGCTTAATGGTACTGGTTCTTGGTCAGGCCAACTCCATGTTAAGTGTAGACTTCTACCATACTTCATGCCGAGAAGCTGAATCAATCATAACG
TCTGCAATGTCTCAAGCTTTTAAGCGAGATCCAACCCTGGCAGCATCGCTTTTACGGTTGCATTTCCATGATTGTTTTGTTCAG
GGCTGTGATGCATCTGTTCTTTTGGATTATACAGAA
CACCATGCCGGGGAAAAGACAGCACTGCCTAACGATCAATCCCTCCGAGGATTTGAGGTCATAGACACCATCAAGGCTGAACTAGAAAAGGCTTGCCCTCACACAGTTTCATGCTCGGAT
GTCATTGCAGCAGTAGCAAGGGACTCTGTGGTTCTG
TCAGGAGGACCTAGATGGAGCGTTGAGTTCGGCAGGAGAGATAGCATTACTGTGGCAAATAATGTTACTGTCCTTCAGGGACTT
CCAAGTCCAAATTCTGAGCTTGCAGATCTGTTGGCAAAATTTGAGCAAATAGGTATGAACCTTAGAGATATAGTAGCTCTCTCAGGGGGGCATACCATAGGCTCTGCAAGGTGTTTTTTT
CTGAAAGGGCAACGACCAAACAGTTGCTCCAGGAATGAAACACATGCTTCTCTGGATCAAACACCCAAGGTTTTTGACAATAACTATTATCTTGCTCTCCTCCGAAAGAATATGAATGGG
GGGTTTTTTCAGTCAGACAATGCCCTTGTGAAGTTTACTCCTGCACTTGACCTTGTTCAGATTTATGCAACGAATTCAACTGCATTCTTTGATGATTTCGCCACATCAATGCTAAAAATG
GGAAGAATTGCTCCTCTTCTAGGTTCTGAAGGTGAAGTACGCATCAACTGTCGTATGGTGAAT

Retrieve as FASTA