Entry information : AcoPrx82 (AcoGoldSmith_v1.023022m)
Entry ID 8627
Creation 2011-07-03 (Qiang Li)
Last sequence changes 2011-12-14 (Qiang Li)
Sequence status partial
Reviewer Not yet reviewed
Last annotation changes 2011-12-14 (Qiang Li)
Peroxidase information: AcoPrx82 (AcoGoldSmith_v1.023022m)
Name (synonym) AcoPrx82 (AcoGoldSmith_v1.023022m)
Class Class III peroxidase    [Orthogroup: N/D] N/D
Taxonomy Eukaryota Viridiplantae Streptophyta Ranunculaceae Aquilegia
Organism Aquilegia coerulea     [TaxId: 218851 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value AcoPrx82
start..stop
S start..stop
BoPrx22-1Ca_other 173 2e-54 5..220 26..244
SaPrx16 167 3e-51 9..159 37..194
SaPrx16 73 0.000000000000002 140..220 251..333
CroPrx08 166 1e-50 13..128 39..156
CroPrx08 71 0.00000000000001 140..220 252..337
SlPrx01 157 1e-49 1..128 13..142
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 2636086..2636244 159 N° 2 2635170..2635361 192 N° 3 2635022..2635054 33 N° 4 2634613..2634888 276
complement(join(2634613..2634888,2635022..2635054,2635170..2635361,2636086..2636 244))


exon

Literature and cross-references AcoPrx82 (AcoGoldSmith_v1.023022m)
DNA ref. Phytozome 12:   scaffold_7 (2636244..2634613)
Protein sequence: AcoPrx82 (AcoGoldSmith_v1.023022m)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   220
PWM (Da):   %s   24597.3  
PI (pH):   %s   4.82
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MFLLNTTIALEVDFYNKACPQVENIIKATLKTKFNEDPTLPASLVRLHFHDCFGCDASILLDDSEKVSSEKNALPNKNSLRGYEVIDEMKSQLEQVCPETVSCADILALSARDSIEQTGGPSWKVLMGVPTHWVWQDVDSPLDSASPFTFDNSFFRQLLLGEGFLRSDKELLMGNGLEVVKRFAINETDFFHQFVLSMIKMGNLLGSNGAEIRRNCRKQN

Retrieve as FASTA  
Remarks Partial sequence from genomic. Incorrect prediction from phytozome (5' end has been completed; Short PS in frame is missing which has not been found in genomic yet).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTTCCTTCTCAACACAACTATAGCACTTGAAGTAGATTTCTACAACAAAGCATGCCCACAAGTCGAGAACATCATCAAAGCAACACTCAAGACCAAATTCAATGAAGATCCAACATTA
CCAGCTTCTTTGGTTAGACTTCATTTTCATGACTGCTTT
GTACAGGTATATATTCTCAACTTCTGTTTCTTTCTTGAGTGTGTTATTCTTCCCATCTTACTTATTTAACATGTTTTTCTT
TTACATTTATCCTTTCAAAACAAAATAATAGCAAAATTCTTAGTTTTTCTTCTTTTTTCATGAAAAATTACTCTTCCTTGCTTCTCTTTTTGTGGTCCATTATTTCTTAATGTCTCTTAA
AAATCTTGAAAAGTTTTGTTAGGATGTTCTGTTAGTAATTTTCACATTTCCAACAACAAAGATTTGTTCTTAATCTATGTTCACATTATCATCAAATTAATTCTTTAATTAAGAGAAAGT
TTTGGGTTGGAGTTGCAAAGTTCAAACATGTATTTCATTAATTAGTAACTGAGAAGGAAATAGGATTTCTTGGGTCTAAAGGTCTAATTAAGGCAAAAGTACCAAAATAAAGAAGAAGAT
AATGATAATTTGAGTTACACAGCTATCAAAAAAAACAACAAAAAAAAACTTGATGATGATCTGATGTTCTGAATGCCAGTAGAGATATCCTTCCTAGTCTTCTATGTGACTTGTCCTTTT
AAGGTTGTGGATGAAAGTGTAATTTCATAGCAAAATGAATATGCATGGGTTTTGCTACTTCCCTTATGTATACAGGATAAATCCCAAGTAATATAGTGTTTGCTACTTATGATTTTACAA
TATGACTACAGAAATAATACATTCAATTCTCTCTCTGTGTTAGGGTTGCGATGCTTCTATCCTTTTGGATGATAGTGAGAAAGTGTCTAGCGAGAAGAATGCATTACCAAACAAGAACTC
CCTCCGTGGTTATGAAGTGATCGATGAAATGAAGTCTCAGTTAGAACAAGTTTGTCCTGAAACAGTATCTTGCGCAGATATACTGGCTCTTTCTGCTAGGGATTCGATTGAACAA
ATAAG
ATTTTCCGTTAATTTGATTTTAGAATATCTTTTTAATTCCTAAAGTTTCCGGTTTTTTTTGTAATTTGTATATCAACCTCTAATTTTTATTTTATTTTTGATCAATTTAGACTGGGGGGC
CTTCATGGAAAGTGCTAATGGGA
AGAAAGGATTCAGTTGGTGCTAATTTTAACGGCGTGAGTGAAGCACTTCCAAGTCCTGGTTTTAATTTACAAAAGCTAGAAGAGTTTTTCTTGGTAA
AAGGTCTTGGGACGAGTGATCTGGTTGCTTTGAGTGGTGCCCACACACTGGGTGTGGCAAGATGTAGATTCTCCATTGGACTCGGCATCACCATTCACGTTTGATAATTCATTTTTCCGT
CAATTACTTTTAGGAGAAGGATTTCTCCGTTCGGATAAGGAACTGTTAATGGGGAATGGGTTGGAAGTAGTCAAGCGGTTTGCTATCAACGAAACTGATTTTTTTCATCAGTTTGTTCTT
TCCATGATCAAGATGGGCAATTTGCTTGGCAGCAATGGAGCGGAAATTCGCAGAAACTGCAGAAAACAAAAT

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTTCCTTCTCAACACAACTATAGCACTTGAAGTAGATTTCTACAACAAAGCATGCCCACAAGTCGAGAACATCATCAAAGCAACACTCAAGACCAAATTCAATGAAGATCCAACATTA
CCAGCTTCTTTGGTTAGACTTCATTTTCATGACTGCTTT
GGTTGCGATGCTTCTATCCTTTTGGATGATAGTGAGAAAGTGTCTAGCGAGAAGAATGCATTACCAAACAAGAACTCCCTC
CGTGGTTATGAAGTGATCGATGAAATGAAGTCTCAGTTAGAACAAGTTTGTCCTGAAACAGTATCTTGCGCAGATATACTGGCTCTTTCTGCTAGGGATTCGATTGAACAA
ACTGGGGGG
CCTTCATGGAAAGTGCTAATGGGA
GTGCCCACACACTGGGTGTGGCAAGATGTAGATTCTCCATTGGACTCGGCATCACCATTCACGTTTGATAATTCATTTTTCCGTCAATTACTTTTA
GGAGAAGGATTTCTCCGTTCGGATAAGGAACTGTTAATGGGGAATGGGTTGGAAGTAGTCAAGCGGTTTGCTATCAACGAAACTGATTTTTTTCATCAGTTTGTTCTTTCCATGATCAAG
ATGGGCAATTTGCTTGGCAGCAATGGAGCGGAAATTCGCAGAAACTGCAGAAAACAAAAT

Retrieve as FASTA