Entry information : AcoPrx84 (AcoGoldSmith_v1.023412m)
Entry ID 8629
Creation 2011-07-03 (Qiang Li)
Last sequence changes 2011-12-07 (Qiang Li)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2015-10-15 (Christophe Dunand)
Peroxidase information: AcoPrx84 (AcoGoldSmith_v1.023412m)
Name (synonym) AcoPrx84 (AcoGoldSmith_v1.023412m)
Class Class III peroxidase    [Orthogroup: Prx193]
Taxonomy Eukaryota Viridiplantae Streptophyta Ranunculaceae Aquilegia
Organism Aquilegia coerulea     [TaxId: 218851 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value AcoPrx84
start..stop
S start..stop
AcoPrx29 662 0 1..326 2..327
AfpPrx28 659 0 1..326 2..327
PtPrx89 312 3e-106 4..325 11..328
GbPrx44 311 5e-106 7..325 13..328
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 2719071..2719286 216 N° 2 2719390..2719581 192 N° 3 2719677..2719845 169 N° 4 2719935..2720335 401
join(2719071..2719286,2719390..2719581,2719677..2719845,2719935..2720335)


exon

Literature and cross-references AcoPrx84 (AcoGoldSmith_v1.023412m)
DNA ref. Phytozome 12:   scaffold_7 (2719071..2720335)
Protein sequence: AcoPrx84 (AcoGoldSmith_v1.023412m)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   326 (305)
PWM (Da):   %s   35921.48 (33654.2)  
PI (pH):   %s   8.25 (8.31) Peptide Signal:   %s   cut: 22 range:22-326
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MKFLAILCLVSLVFFISDVGAEKDGLKLDYYKKTSCPQAEEVVAKMMKDIVTDDFRVAPRILRMHFHDCFVRGCEGSILLNSTSTEKAEKEARPNNPSLKGFDVIDRIKAELEKQCPKVVSCADILAYAARESVKLTGKCRAYAVRGGRKDGLISREIEALQNLPPPSANVSTLIKSFASKGLSLQEMVTLSGGHSIGRSFCAAILGRHNNFNNTGKPDPTLNSDLAAKLRKQCVALTDLVDMDTITPNTLDNKYYRGLLENKGLFTSDAALLTNNETLKEVKSNDFLPSAYWENKFVKAMIKMGEIDVLTGDEGQIREKCYVVN

Retrieve as FASTA  
Remarks Complete sequence from genomic (3 introns).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAAGTTTCTTGCAATTCTTTGCCTAGTTTCCCTGGTGTTTTTCATATCAGATGTGGGAGCTGAAAAGGATGGTTTAAAACTTGATTACTACAAAAAAACATCATGTCCACAAGCCGAG
GAAGTTGTCGCTAAGATGATGAAAGATATTGTTACAGATGATTTCAGGGTTGCTCCTAGGATACTAAGGATGCATTTCCATGATTGTTTTGTAAGG
GTGTGTATTGCATCAATGAACTTC
CAATACCGAGGTTAATTTAGAGTGTAATAAAACAATAAGCATGTCTTACATTTTGTGTTTTACATCTGTTTTCTCGCAGGGATGTGAGGGATCGATCCTCCTTAACTCTACATCAACTGA
GAAGGCAGAGAAAGAGGCACGTCCTAATAATCCTAGTCTTAAAGGCTTTGATGTGATTGATCGAATTAAAGCAGAATTGGAAAAGCAATGTCCCAAGGTTGTATCATGCGCTGACATTCT
TGCCTACGCAGCTAGAGAGAGTGTTAAACTG
GTAGGTATATATATGAAGTATGAAGATGAACACTTGACTTAACAACTCCATTAAAATTGTGATTCTCACTGATCTTTTTGCTTGGCGAC
AATTAGACTGGTAAGTGCAGGGCTTATGCTGTTCGAGGAGGACGTAAAGATGGTCTGATTTCTAGAGAGATAGAAGCACTCCAAAATCTCCCACCACCTTCTGCTAACGTCAGTACACTT
ATAAAAAGTTTTGCTTCTAAGGGCTTATCACTTCAAGAAATGGTAACCCTCTCAG
GTAATGCAAGCGAATGAAGAACTCTTTACAATATATGTTCCTAGCCTTTCTAAACCTAAGAAATT
ATCAAATTGTTGTGTCGTTTGTAGGAGGACATTCCATAGGTCGTTCATTTTGTGCTGCGATCTTAGGAAGACACAACAACTTCAACAACACTGGAAAACCAGATCCCACTCTCAATAGCG
ATCTGGCTGCAAAATTAAGAAAACAATGTGTCGCTTTAACTGACTTGGTTGACATGGACACAATTACACCTAACACTCTAGATAACAAATATTACAGAGGTTTGTTGGAGAACAAAGGCT
TATTTACATCGGACGCAGCTTTGCTCACCAATAATGAAACTTTAAAAGAAGTTAAAAGCAATGATTTTCTACCATCAGCTTATTGGGAGAATAAGTTTGTTAAGGCAATGATCAAAATGG
GAGAAATAGATGTTCTAACTGGAGATGAAGGACAGATCAGAGAAAAGTGTTACGTCGTAAATAAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAAGTTTCTTGCAATTCTTTGCCTAGTTTCCCTGGTGTTTTTCATATCAGATGTGGGAGCTGAAAAGGATGGTTTAAAACTTGATTACTACAAAAAAACATCATGTCCACAAGCCGAG
GAAGTTGTCGCTAAGATGATGAAAGATATTGTTACAGATGATTTCAGGGTTGCTCCTAGGATACTAAGGATGCATTTCCATGATTGTTTTGTAAGG
GGATGTGAGGGATCGATCCTCCTT
AACTCTACATCAACTGAGAAGGCAGAGAAAGAGGCACGTCCTAATAATCCTAGTCTTAAAGGCTTTGATGTGATTGATCGAATTAAAGCAGAATTGGAAAAGCAATGTCCCAAGGTTGTA
TCATGCGCTGACATTCTTGCCTACGCAGCTAGAGAGAGTGTTAAACTG
ACTGGTAAGTGCAGGGCTTATGCTGTTCGAGGAGGACGTAAAGATGGTCTGATTTCTAGAGAGATAGAAGCA
CTCCAAAATCTCCCACCACCTTCTGCTAACGTCAGTACACTTATAAAAAGTTTTGCTTCTAAGGGCTTATCACTTCAAGAAATGGTAACCCTCTCAG
GAGGACATTCCATAGGTCGTTCA
TTTTGTGCTGCGATCTTAGGAAGACACAACAACTTCAACAACACTGGAAAACCAGATCCCACTCTCAATAGCGATCTGGCTGCAAAATTAAGAAAACAATGTGTCGCTTTAACTGACTTG
GTTGACATGGACACAATTACACCTAACACTCTAGATAACAAATATTACAGAGGTTTGTTGGAGAACAAAGGCTTATTTACATCGGACGCAGCTTTGCTCACCAATAATGAAACTTTAAAA
GAAGTTAAAAGCAATGATTTTCTACCATCAGCTTATTGGGAGAATAAGTTTGTTAAGGCAATGATCAAAATGGGAGAAATAGATGTTCTAACTGGAGATGAAGGACAGATCAGAGAAAAG
TGTTACGTCGTAAATAAG

Retrieve as FASTA