Entry information : AcoPrx85 (AcoGoldSmith_v1.024352m)
Entry ID 8630
Creation 2011-07-03 (Qiang Li)
Last sequence changes 2011-12-07 (Qiang Li)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2015-10-15 (Christophe Dunand)
Peroxidase information: AcoPrx85 (AcoGoldSmith_v1.024352m)
Name (synonym) AcoPrx85 (AcoGoldSmith_v1.024352m)
Class Class III peroxidase    [Orthogroup: Prx005]
Taxonomy Eukaryota Viridiplantae Streptophyta Ranunculaceae Aquilegia
Organism Aquilegia coerulea     [TaxId: 218851 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value AcoPrx85
start..stop
S start..stop
GhPrx22 519 0 20..327 26..333
PpePrx07 517 0 6..326 11..332
ThasPrx31 515 0 5..327 18..340
AtPrx53 509 0 5..327 13..335
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 1310800..1311006 207 N° 2 1310484..1310675 192 N° 3 1310240..1310405 166 N° 4 1309749..1310164 416
complement(join(1309749..1310164,1310240..1310405,1310484..1310675,1310800..1311 006))


exon

Literature and cross-references AcoPrx85 (AcoGoldSmith_v1.024352m)
DNA ref. Phytozome 12:   scaffold_9 (1311006..1309749)
Protein sequence: AcoPrx85 (AcoGoldSmith_v1.024352m)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   327 (305)
PWM (Da):   %s   34628.04 (32225.8)  
PI (pH):   %s   6.24 (6.24) Peptide Signal:   %s   cut: 23 range:23-327
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MSSYLLILVVPFIGYMFGVSNAQLNSTFYANTCPNISSIVRGVVQQALQSDARIGASLIRLHFHDCFVNGCDGSILLDDTNTIQSEKNAGPNVNSARGFNVVDNIKTALENACPRVVSCADILAVASEASVSLAGGPSWSVLLGRRDSRIASQAGANTSIPNPFEGLSNLTAKFSAVGLSTTDLVALSGAHTFGRAQCRLFSNRLYNFSGNGNPDQTLSSSYLATLRQACPQNGSGSTLNNLDPSTPNTFDNNYFSNLQNNQGLLQSDQELFSTTGAATIAIVNNFASNQSTFFQNFVQSMINMGNISPLLGNNGEIRSDCKRVNG

Retrieve as FASTA  
Remarks Complete sequence from genomic (3 introns). Incorrect prediction from phytozome (5' end is missing).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTCTTCTTATCTTTTGATTCTAGTAGTTCCTTTCATAGGATATATGTTTGGGGTGTCGAATGCTCAACTAAATTCAACCTTTTATGCTAACACATGTCCCAATATCTCAAGCATTGTT
CGAGGTGTTGTGCAACAGGCTTTGCAATCAGATGCTCGAATAGGCGCAAGCCTCATTCGACTTCATTTTCACGACTGTTTTGTTAAT
GTAAATCCAATGCTCTTATCTCCCATTTCTTAG
CTGCGTCACTTCTTTTTTTATTTCAGAAATAAACTTATAAAATTGCTTTTTGTTAGAGGTACTAAAAACATCTAAACTGGTGATCTTGTAGGGTTGTGATGGATCAATTTTGTTAGATGA
CACTAACACCATACAAAGTGAGAAAAACGCCGGTCCAAATGTTAACTCGGCCAGAGGTTTCAATGTTGTCGATAATATCAAGACTGCATTGGAAAATGCTTGCCCCAGGGTTGTCTCGTG
TGCTGACATACTTGCAGTTGCATCGGAGGCTTCTGTTTCTTTG
GTATAATTTCTCAAAGTGAACTTAGCTTGTTTTTCATGCGCCGGCACATACCTTACCATGTTTGATTTATGTTTGTA
GGCAGGAGGTCCTTCATGGAGTGTCTTACTAGGAAGAAGGGATAGCAGGATAGCAAGCCAAGCTGGAGCTAATACCTCGATTCCTAACCCGTTTGAAGGACTAAGCAATTTAACTGCAAA
GTTCTCCGCAGTTGGACTCAGCACCACTGACTTAGTAGCATTGTCTG
GTAAGTAATACACATAGGATACATTTCTTTAAGAGAACTACCAGATTCTCACAACAAAGTAATTATTTTGCAC
AGGAGCTCACACATTTGGACGTGCACAATGTCGATTATTTAGTAATCGTTTGTACAACTTCAGTGGAAATGGGAACCCTGATCAAACATTAAGCTCATCCTACCTAGCTACTCTTCGCCA
AGCTTGTCCACAAAATGGGAGTGGAAGCACTTTGAATAACCTGGACCCTAGCACACCCAATACTTTTGACAATAACTACTTCAGCAACCTTCAAAATAATCAAGGTCTACTCCAATCAGA
TCAAGAATTATTCTCAACTACAGGAGCTGCGACAATTGCCATTGTTAACAACTTTGCTAGTAATCAAAGCACATTCTTTCAAAATTTTGTGCAATCTATGATAAACATGGGCAACATCAG
CCCATTATTGGGAAACAATGGAGAGATTCGGTCTGATTGTAAGAGAGTTAATGGCAGT

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTCTTCTTATCTTTTGATTCTAGTAGTTCCTTTCATAGGATATATGTTTGGGGTGTCGAATGCTCAACTAAATTCAACCTTTTATGCTAACACATGTCCCAATATCTCAAGCATTGTT
CGAGGTGTTGTGCAACAGGCTTTGCAATCAGATGCTCGAATAGGCGCAAGCCTCATTCGACTTCATTTTCACGACTGTTTTGTTAAT
GGTTGTGATGGATCAATTTTGTTAGATGACACT
AACACCATACAAAGTGAGAAAAACGCCGGTCCAAATGTTAACTCGGCCAGAGGTTTCAATGTTGTCGATAATATCAAGACTGCATTGGAAAATGCTTGCCCCAGGGTTGTCTCGTGTGCT
GACATACTTGCAGTTGCATCGGAGGCTTCTGTTTCTTTG
GCAGGAGGTCCTTCATGGAGTGTCTTACTAGGAAGAAGGGATAGCAGGATAGCAAGCCAAGCTGGAGCTAATACCTCGATT
CCTAACCCGTTTGAAGGACTAAGCAATTTAACTGCAAAGTTCTCCGCAGTTGGACTCAGCACCACTGACTTAGTAGCATTGTCTG
GAGCTCACACATTTGGACGTGCACAATGTCGATTA
TTTAGTAATCGTTTGTACAACTTCAGTGGAAATGGGAACCCTGATCAAACATTAAGCTCATCCTACCTAGCTACTCTTCGCCAAGCTTGTCCACAAAATGGGAGTGGAAGCACTTTGAAT
AACCTGGACCCTAGCACACCCAATACTTTTGACAATAACTACTTCAGCAACCTTCAAAATAATCAAGGTCTACTCCAATCAGATCAAGAATTATTCTCAACTACAGGAGCTGCGACAATT
GCCATTGTTAACAACTTTGCTAGTAATCAAAGCACATTCTTTCAAAATTTTGTGCAATCTATGATAAACATGGGCAACATCAGCCCATTATTGGGAAACAATGGAGAGATTCGGTCTGAT
TGTAAGAGAGTTAATGGCAGT

Retrieve as FASTA