Entry information : AcoPrx86 (AcoGoldSmith_v1.024499m)
Entry ID 8631
Creation 2011-07-03 (Qiang Li)
Last sequence changes 2011-12-07 (Qiang Li)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2015-10-15 (Christophe Dunand)
Peroxidase information: AcoPrx86 (AcoGoldSmith_v1.024499m)
Name (synonym) AcoPrx86 (AcoGoldSmith_v1.024499m)
Class Class III peroxidase    [Orthogroup: Prx222]
Taxonomy Eukaryota Viridiplantae Streptophyta Ranunculaceae Aquilegia
Organism Aquilegia coerulea     [TaxId: 218851 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value AcoPrx86
start..stop
S start..stop
AcoPrx28 604 0 1..327 1..326
AfpPrx03 498 1e-179 1..327 1..325
AcoPrx30 496 8e-179 1..327 1..325
PtPrx27 462 2e-165 7..327 7..326
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 942327..942539 213 N° 2 941711..941905 195 N° 3 941436..941598 163 N° 4 940913..941325 413
complement(join(940913..941325,941436..941598,941711..941905,942327..942539))


exon

Literature and cross-references AcoPrx86 (AcoGoldSmith_v1.024499m)
DNA ref. Phytozome 12:   scaffold_47 (942539..940913)
Protein sequence: AcoPrx86 (AcoGoldSmith_v1.024499m)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   328 (304)
PWM (Da):   %s   35620.23 (33111.8) Transmb domain:   %s   i7-24o
PI (pH):   %s   7.9 (7.06) Peptide Signal:   %s   cut: 25 range:25-328
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MGKKSCFVKIILCVLGFLIGSTVADLKMGFYDKNCPNAEKIVLGYVKKHISNVPSLAAPLLRMAFHDCFVRGCDASVLLNATLNNQAAEKDARPNLSLRGFDFIDEVKSLLEAECPDIVSCADIISLVARDSVVTMGGPYWKVPTGRRDGTISRASEALSNLPGANENFNALQTKFELKGLNIKDLVLLSGAHTIGIAHCSPFSNRIYNFTGVGDQDPALDNDYAINLRANKCKTPTDITTIVEMDPGSSKHFDLSYYKLLVKKRGLFQSDATLTTDSSSIAVINQLLEKSPLYFFAEFAKSMEKMGDVGVKTGTDGQIRKHCALVN

Retrieve as FASTA  
Remarks Complete sequence from genomic (3 introns). Incorrect prediction from phytozome (5' end is missing).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGGAAAGAAGAGTTGTTTTGTGAAAATAATTTTGTGTGTTCTGGGTTTTTTAATTGGTTCAACAGTTGCTGATTTGAAGATGGGTTTTTATGATAAAAATTGCCCAAATGCTGAAAAG
ATTGTGTTGGGCTACGTAAAAAAGCATATTTCAAATGTCCCAAGTTTGGCTGCACCGTTACTTAGAATGGCCTTCCATGACTGCTTTGTGAGG
GTTAGTATATATATGTTTCTCTTTATA
CTGGCTACTTGAGACATGGATATACCGCACGACTGGATAATATATTGTTTTCTTCTCTTTTCTCTTTTACGAGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCTTCTATTTGTTTAAAA
GAAGAGAATTATATCTTGTGTTCTGAACATATAAGACTAGCCTTTATAACAGATTATGGGATTGCATCACTGTCGTGTTATCAGTTATCACTAAGAAGCATATACGTATAACTTGATATC
AACCTATGAGAAAAGAAAAATACATCTTTTTGGGTTTACCGGTCTCGTAATGGATTGTGTTTATTTGGGTAATATATTTGCTCTTCATTTATGCTTTGTTTTCAATCTATAAATGTATGA
TATTTCGTAAATAACAAATTCTTGTTAAATGTAGGGTTGCGATGCCTCAGTTCTCCTGAACGCTACTTTAAACAACCAAGCTGCAGAGAAGGATGCTCGTCCAAATCTATCCCTTCGAGG
ATTTGATTTCATTGATGAAGTGAAGAGTTTATTAGAAGCTGAATGTCCAGACATTGTTTCATGTGCAGACATTATCTCTTTGGTTGCAAGAGATTCAGTTGTCACTATG
GTAAGGATAAT
TAATCTAAGTGNNNNNNNNNNNNNNNNNNNNNCTTTCATTACTTCAATAAATCTATAGCAAAATAAAATTTTAAACATGCATTGTGAATTTAAATCAATAGGGAGGTCCATATTGGAAAG
TCCCAACGGGTCGTAGAGATGGGACTATATCTAGAGCCTCAGAAGCCTTGAGCAATCTCCCTGGAGCAAATGAAAACTTTAATGCCCTCCAGACAAAATTTGAGCTCAAAGGACTCAACA
TAAAAGATCTTGTTCTATTGTCTG
GTATTTTTTATAAAAATCTACTCATACATTATTTCTCTCTTTTAATGATTTCTATCCAGAAATTTTGTTTATAACTAACACCTTTCATCAATATGA
TTATGTCTCCGTAGGTGCTCACACAATTGGGATCGCTCACTGCAGTCCATTTTCGAATCGAATATACAATTTTACAGGGGTAGGAGATCAAGATCCTGCTTTGGACAATGATTATGCTAT
AAATTTGAGAGCAAATAAGTGTAAAACTCCTACTGATATCACGACCATAGTTGAGATGGATCCAGGTAGTTCAAAACATTTCGACCTTAGCTATTACAAACTCTTAGTTAAAAAGCGAGG
ACTATTTCAATCAGATGCAACTCTTACCACTGACTCTAGTTCAATAGCTGTTATCAACCAACTTCTCGAGAAATCACCATTATATTTCTTTGCGGAGTTTGCTAAATCGATGGAAAAGAT
GGGTGATGTTGGTGTAAAAACTGGAACAGATGGTCAGATAAGGAAACATTGCGCACTGGTGAATGGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGGAAAGAAGAGTTGTTTTGTGAAAATAATTTTGTGTGTTCTGGGTTTTTTAATTGGTTCAACAGTTGCTGATTTGAAGATGGGTTTTTATGATAAAAATTGCCCAAATGCTGAAAAG
ATTGTGTTGGGCTACGTAAAAAAGCATATTTCAAATGTCCCAAGTTTGGCTGCACCGTTACTTAGAATGGCCTTCCATGACTGCTTTGTGAGG
GGTTGCGATGCCTCAGTTCTCCTGAAC
GCTACTTTAAACAACCAAGCTGCAGAGAAGGATGCTCGTCCAAATCTATCCCTTCGAGGATTTGATTTCATTGATGAAGTGAAGAGTTTATTAGAAGCTGAATGTCCAGACATTGTTTCA
TGTGCAGACATTATCTCTTTGGTTGCAAGAGATTCAGTTGTCACTATG
GGAGGTCCATATTGGAAAGTCCCAACGGGTCGTAGAGATGGGACTATATCTAGAGCCTCAGAAGCCTTGAGC
AATCTCCCTGGAGCAAATGAAAACTTTAATGCCCTCCAGACAAAATTTGAGCTCAAAGGACTCAACATAAAAGATCTTGTTCTATTGTCTG
GTGCTCACACAATTGGGATCGCTCACTGC
AGTCCATTTTCGAATCGAATATACAATTTTACAGGGGTAGGAGATCAAGATCCTGCTTTGGACAATGATTATGCTATAAATTTGAGAGCAAATAAGTGTAAAACTCCTACTGATATCACG
ACCATAGTTGAGATGGATCCAGGTAGTTCAAAACATTTCGACCTTAGCTATTACAAACTCTTAGTTAAAAAGCGAGGACTATTTCAATCAGATGCAACTCTTACCACTGACTCTAGTTCA
ATAGCTGTTATCAACCAACTTCTCGAGAAATCACCATTATATTTCTTTGCGGAGTTTGCTAAATCGATGGAAAAGATGGGTGATGTTGGTGTAAAAACTGGAACAGATGGTCAGATAAGG
AAACATTGCGCACTGGTGAATGGA

Retrieve as FASTA