Entry information : AcoPrx87 (AcoGoldSmith_v1.024753m)
Entry ID 8632
Creation 2011-07-03 (Qiang Li)
Last sequence changes 2011-10-03 (Qiang Li)
Sequence status partial
Reviewer Qiang Li
Last annotation changes 2011-12-14 (Qiang Li)
Peroxidase information: AcoPrx87 (AcoGoldSmith_v1.024753m)
Name (synonym) AcoPrx87 (AcoGoldSmith_v1.024753m)
Class Class III peroxidase     [Orthogroup: Prx003]*
Taxonomy Eukaryota Viridiplantae Streptophyta Ranunculaceae Aquilegia
Organism Aquilegia coerulea     [TaxId: 218851 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value AcoPrx87
start..stop
S start..stop
AcoPrx86 331 2e-116 4..171 5..172
AcoPrx28 301 1e-104 4..171 5..171
AcoPrx30 258 9e-88 4..171 5..170
AfpPrx03 257 3e-87 4..171 5..170
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 936417..936425 9 N° 2 935705..935905 201 N° 3 935097..935291 195 N° 4 934867..934974 108
complement(join(934867..934974,935097..935291,935705..935905,936417..936425))


exon

Literature and cross-references AcoPrx87 (AcoGoldSmith_v1.024753m)
DNA ref. Phytozome 12:   scaffold_47 (936425..934867)
Protein sequence: AcoPrx87 (AcoGoldSmith_v1.024753m)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   171 (148)
PWM (Da):   %s   18352.44 (15973.1)  
PI (pH):   %s   7.18 (6.50) Peptide Signal:   %s   cut: 24 range:24-171
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MALSCFVKIILCVLGFLIGSTVADLKMGFYDKNCPNAEKIVLAYVKKHISNVPSLAAPLLRMAFHDCFVRGCDASLLLNATLNNQVAEKDARPNLSLRGFDFINEVKSLLEAECPGIVSCADIISLVARDSIVAMGGPYWKVPTERRDGTISKASEALSNLPGANENFNAL

Retrieve as FASTA  
Remarks Partial sequence from genomic. Incorrect prediction from phytozome (3' end is missing which has been completed).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCCCTGGTACACATTTAGTTTGTTTGTCCAACTAAGCAATTAATAATTTAATCTTAACTTAATGTGTTAATTGAGATTTTTAAAGGCTTTTTTTTTTTAGCATAGTCAAGGGATAAG
GATTTAATATGAACCAAAAGCCATGTAGATTCATTACATTACCATGAATCCATATAATAAACTGAAAATGTGTGGTTGCAAATAGGCACATAGCTATTGTTGTAAAAAAACAACATTCAA
ATACTATTTTTCAGATCTTCCATTACTTGTTTTGTCTAGGACTCTAAGGGTGAAGCCAAACTGATTAGCAACCTAGGAACAAATTAAAAAATAAATAGATAATTAGTAGTACATCAGCAC
ATATGTTGATTATATTGGTATGTTTAATGATTTTGATCACAAGTTTTCTTCTCAAAACTTCTATATAAAGCAAACTTACTTTAAGCTAAGTACCAACAAACTAAGTATACATTAAGGAAG
TTCACAAGTCTTAACATATCGTATCATAATGGGAAAGAAGAGTTGTTTTGTGAAAATAATTTTGTGTGTTCTGGGTTTTTTAATTGGTTCAACAGTTGCTGATTTGAAAATGGGGTTTTA
TGATAAAAATTGCCCAAATGCTGAAAAGATTGTGTTGGCCTACGTAAAGAAGCATATTTCAAATGTCCCAAGTTTGGCTGCACCGTTACTTAGAATGGCCTTCCATGACTGCTTTGTGAG
G
GTTAGTATATGTTTCTCTTTATACTGGGTATTTGAGACATGGAATTACCGACCAGATAATATATTGTTTTCTTCTCTTTTCTCTTTTACGAGCTTTTCGTAAAATCTTAGGTTATATAT
TTTCTTTTATTTGTTTAAAAGAAGAGAATTATATCTTGTGTTTTGAATATATAAGACTAGCCTTTATAACTGAAAATTATGCGATTGCATCATTGTTGTGTTATTAGTTATGATTAAGAA
GCATATACATATAACTTGATCTCAACTTATGGGTAAAAAAAACATCTTTTTGGATTTACCGGTCTTGTAATGGATTGTGTCTATTTGGGTAATATATTTGCTCTTCATTTATGCTTTGTT
TTCATTCTATAAATGTATGATATTTCGTAAAAAACAAATTCTTGTTAAATGTAGGGTTGCGATGCCTCACTTCTCCTGAACGCTACTTTAAACAACCAAGTTGCAGAGAAGGATGCTCGT
CCAAATCTATCCCTTCGAGGATTTGATTTCATCAATGAAGTGAAGAGTTTATTAGAAGCTGAATGTCCAGGGATTGTTTCGTGTGCAGATATTATCTCTTTGGTTGCAAGAGATTCAATT
GTCGCTATG
GTAAGGATAATTAATCTAGTGAACNNNNNNNNNNNNNNNNNNNNTAGTTTTATCTCTCATTACTTCAATAAATCTATAGCAAAATAAAATTTTAAACATGCATTGTGAAAC
TAAATCAATAGGGAGGTCCATATTGGAAAGTCCCAACGGAGCGTAGAGATGGGACTATATCAAAAGCCTCAGAAGCCTTGAGCAATCTCCCTGGAGCAAATGAAAACTTCAATGCCCTC

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCCCTGAGTTGTTTTGTGAAAATAATTTTGTGTGTTCTGGGTTTTTTAATTGGTTCAACAGTTGCTGATTTGAAAATGGGGTTTTATGATAAAAATTGCCCAAATGCTGAAAAGATT
GTGTTGGCCTACGTAAAGAAGCATATTTCAAATGTCCCAAGTTTGGCTGCACCGTTACTTAGAATGGCCTTCCATGACTGCTTTGTGAGG
GGTTGCGATGCCTCACTTCTCCTGAACGCT
ACTTTAAACAACCAAGTTGCAGAGAAGGATGCTCGTCCAAATCTATCCCTTCGAGGATTTGATTTCATCAATGAAGTGAAGAGTTTATTAGAAGCTGAATGTCCAGGGATTGTTTCGTGT
GCAGATATTATCTCTTTGGTTGCAAGAGATTCAATTGTCGCTATG
GGAGGTCCATATTGGAAAGTCCCAACGGAGCGTAGAGATGGGACTATATCAAAAGCCTCAGAAGCCTTGAGCAAT
CTCCCTGGAGCAAATGAAAACTTCAATGCCCTC

Retrieve as FASTA