Entry information : AcoPrx89 (AcoGoldSmith_v1.024922m)
Entry ID 8633
Creation 2011-07-03 (Qiang Li)
Last sequence changes 2011-12-07 (Qiang Li)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2015-10-15 (Christophe Dunand)
Peroxidase information: AcoPrx89 (AcoGoldSmith_v1.024922m)
Name (synonym) AcoPrx89 (AcoGoldSmith_v1.024922m)
Class Class III peroxidase    [Orthogroup: Prx029]
Taxonomy Eukaryota Viridiplantae Streptophyta Ranunculaceae Aquilegia
Organism Aquilegia coerulea     [TaxId: 218851 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value AcoPrx89
start..stop
S start..stop
PpePrx77 444 6e-158 9..336 13..341
PtPrx37 439 5e-156 1..340 1..340
GrPrx02 436 1e-154 1..336 1..337
CclPrx88 435 4e-154 9..338 2..332
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 2696031..2696276 246 N° 2 2696385..2696567 183 N° 3 2696796..2696955 160 N° 4 2697053..2697489 437
join(2696031..2696276,2696385..2696567,2696796..2696955,2697053..2697489)


exon

Literature and cross-references AcoPrx89 (AcoGoldSmith_v1.024922m)
DNA ref. Phytozome 12:   scaffold_28 (2696031..2697489)
Protein sequence: AcoPrx89 (AcoGoldSmith_v1.024922m)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   342 (316)
PWM (Da):   %s   37608.33 (34907.9) Transmb domain:   %s   i7-29o
PI (pH):   %s   8.61 (8.55) Peptide Signal:   %s   cut: 27 range:27-342
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MRRDGGGCVLVLLAIVLISYLSVSNAQVGLPKTGLVRQFYKKNDTCADVEEFIKHQVKLFWTKDRSITPKLLRLVYSDCFVTGCDASILLDKPDNPEKKAPQNIGLGGFVFIDQIKKVVESRCPGVVSCADILMLAARDAVHLAGAPSYPVLTGRRDGLQSSAASVDLPSPSISFDDALSLFESKGLNVLDMVTLLGAHTMGSTRCRYILDRLYNFNGSKKPDPSMDKTLLDELRNKCPPKTRKGQTDPLVFINKNSGTKYTFNNSYYSHVLNKQAVLGIDQLLLSTEDSTDITQEFADGFEDFRRSWAFSMNKMGSIGVLTGTKGEIRRNCRLTNADNPI

Retrieve as FASTA  
Remarks Complete sequence from genomic (3 introns). Containing motif 'YSDC'.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAGAAGAGATGGAGGGGGTTGTGTTCTTGTGTTGTTAGCTATTGTTCTTATATCTTACTTATCAGTTTCGAATGCACAAGTTGGCCTACCGAAGACAGGATTGGTACGCCAATTTTAT
AAGAAGAATGATACTTGTGCTGATGTCGAGGAGTTCATCAAGCACCAAGTGAAGTTATTTTGGACGAAAGATCGTAGTATCACTCCAAAACTTCTTCGTTTGGTGTATTCTGATTGCTTT
GTTACG
GTATACCTTCATATATATCTTACATCTTACGCGTCTTAAACCTTCAATTTTATTGAACTAATTTAAGTATTGTTGTTTAGTCGATATAATGTGTTGTTTTTCATACAGGGATGT
GATGCATCAATTCTGTTAGACAAACCTGACAACCCGGAGAAAAAAGCACCACAAAATATTGGGCTTGGAGGATTTGTCTTCATTGACCAAATCAAAAAGGTCGTCGAAAGTAGGTGCCCA
GGAGTTGTATCCTGCGCTGACATCCTTATGCTTGCAGCTAGAGATGCAGTTCATCTG
GTATAACTATTTATCACTCAGTATGCATGGTAACTATTAAAGGGGCATAAGCCAACGGGTATA
ACATATATACTCTTTAGAGGCACTGGGGCTAGTTGAGTGCCTTCACATCCAGTGGCAGACTGCTAGCTCCAGCGCATCTCATCGAGAAATAAATGTTTCGCGCTTAACTGAATAATATGC
ATTTCCATATTTTCTTGTGTATTTTAAATATGTGCGAAAATACAGGCCGGTGCACCATCCTATCCAGTTCTGACAGGGAGAAGAGATGGTCTTCAATCAAGTGCAGCATCTGTTGACCTA
CCTTCACCATCCATCTCATTCGACGATGCACTCTCTCTTTTCGAATCCAAAGGTCTAAATGTATTAGATATGGTTACTCTCCTAG
GNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCATTGGAACATGTTTGCAGGAGCACATACGATGGGCTCAACACGTTGCCGCTACATCCTTGACAGGCTTTACAACTT
CAATGGTTCAAAAAAGCCTGATCCAAGTATGGACAAAACCCTTTTAGATGAATTGAGGAACAAATGTCCACCAAAGACCAGAAAGGGCCAAACAGATCCACTTGTGTTTATAAACAAAAA
TTCAGGAACAAAATACACTTTCAACAACTCATACTACTCTCATGTGTTAAACAAACAAGCTGTTCTTGGTATTGATCAATTACTACTCTCTACTGAGGATTCCACAGATATTACCCAAGA
ATTTGCAGATGGATTCGAAGATTTTCGAAGATCTTGGGCTTTTTCGATGAACAAGATGGGAAGCATTGGTGTCCTTACTGGTACTAAGGGGGAAATACGTCGCAATTGCCGCTTAACGAA
TGCGGATAACCCCATTCAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAGAAGAGATGGAGGGGGTTGTGTTCTTGTGTTGTTAGCTATTGTTCTTATATCTTACTTATCAGTTTCGAATGCACAAGTTGGCCTACCGAAGACAGGATTGGTACGCCAATTTTAT
AAGAAGAATGATACTTGTGCTGATGTCGAGGAGTTCATCAAGCACCAAGTGAAGTTATTTTGGACGAAAGATCGTAGTATCACTCCAAAACTTCTTCGTTTGGTGTATTCTGATTGCTTT
GTTACG
GGATGTGATGCATCAATTCTGTTAGACAAACCTGACAACCCGGAGAAAAAAGCACCACAAAATATTGGGCTTGGAGGATTTGTCTTCATTGACCAAATCAAAAAGGTCGTCGAA
AGTAGGTGCCCAGGAGTTGTATCCTGCGCTGACATCCTTATGCTTGCAGCTAGAGATGCAGTTCATCTG
GCCGGTGCACCATCCTATCCAGTTCTGACAGGGAGAAGAGATGGTCTTCAA
TCAAGTGCAGCATCTGTTGACCTACCTTCACCATCCATCTCATTCGACGATGCACTCTCTCTTTTCGAATCCAAAGGTCTAAATGTATTAGATATGGTTACTCTCCTAG
GAGCACATACG
ATGGGCTCAACACGTTGCCGCTACATCCTTGACAGGCTTTACAACTTCAATGGTTCAAAAAAGCCTGATCCAAGTATGGACAAAACCCTTTTAGATGAATTGAGGAACAAATGTCCACCA
AAGACCAGAAAGGGCCAAACAGATCCACTTGTGTTTATAAACAAAAATTCAGGAACAAAATACACTTTCAACAACTCATACTACTCTCATGTGTTAAACAAACAAGCTGTTCTTGGTATT
GATCAATTACTACTCTCTACTGAGGATTCCACAGATATTACCCAAGAATTTGCAGATGGATTCGAAGATTTTCGAAGATCTTGGGCTTTTTCGATGAACAAGATGGGAAGCATTGGTGTC
CTTACTGGTACTAAGGGGGAAATACGTCGCAATTGCCGCTTAACGAATGCGGATAACCCCATTCAA

Retrieve as FASTA