Entry information : AcoPrx90 (AcoGoldSmith_v1.025125m)
Entry ID 8634
Creation 2011-07-03 (Qiang Li)
Last sequence changes 2011-12-13 (Qiang Li)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2011-12-14 (Qiang Li)
Peroxidase information: AcoPrx90 (AcoGoldSmith_v1.025125m)
Name (synonym) AcoPrx90 (AcoGoldSmith_v1.025125m)
Class Class III peroxidase    [Orthogroup: Prx134]
Taxonomy Eukaryota Viridiplantae Streptophyta Ranunculaceae Aquilegia
Organism Aquilegia coerulea     [TaxId: 218851 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value AcoPrx90
start..stop
S start..stop
AcoPrx38 580 0 9..317 14..322
AcoPrx72 504 0 1..317 1..319
AcoPrx65 491 3e-177 1..317 1..315
AcoPrx94 479 2e-172 1..306 1..307
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 1577088..1577309 222 N° 2 1577388..1577567 180 N° 3 1577673..1578221 549  
join(1577088..1577309,1577388..1577567,1577673..1578221)


exon

Literature and cross-references AcoPrx90 (AcoGoldSmith_v1.025125m)
DNA ref. Phytozome 12:   scaffold_2 (1577088..1578221)
Protein sequence: AcoPrx90 (AcoGoldSmith_v1.025125m)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   317 (290)
PWM (Da):   %s   33955.01 (31021.4) Transmb domain:   %s   i9-31o
PI (pH):   %s   8.76 (8.58) Peptide Signal:   %s   cut: 28 range:28-317
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MTSSIHRTVLLSLFVIFLTTFSSPALAQLSVSFYGSTCPSVFDTVRAATRSAINRETRMGASILRLFFHDCFVGGCNGGILLAGGERNAPANGDTVRGFDVIDNIKRQVDTACGRSVVSCADILAISARDSIIELGGQSYSVPLGRRDTRTPNLAAARSDLPSPFDPLNTIIDKFSRKGFSAREMVALSGAHTVGQARCSSFRDRIYNATNIDPDFAATRQANCPRTGGDSNLAPLDPQSQARFGNNYFQALLNRRGLLSSDQALFNGGSTDSIVRTYSNDANAFLTDFTNAMVKMGNLSPLTGTQGEIRTTCQRVN

Retrieve as FASTA  
Remarks Complete sequence from genomic. Incorrect prediction from phytozome (5' end is missing which has been completed).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGACTTCTAGTATTCATCGTACTGTTTTATTAAGTCTTTTTGTGATCTTCCTTACCACCTTTTCATCTCCAGCCCTTGCACAGCTCTCAGTCTCCTTTTATGGTAGTACATGTCCATCA
GTTTTTGACACTGTTAGAGCAGCCACACGCTCGGCTATAAACAGAGAAACTCGAATGGGGGCTTCCATTTTACGTCTTTTCTTCCATGATTGTTTTGTTGGT
GTAAGTTGAACATATGAG
TTCGTTTACAATTATATTAATTATTACTAATTCTAAAATCGTTCCGCTTAACAAATCCAGGGTTGTAATGGTGGGATTCTTTTGGCCGGTGGTGAAAGAAATGCACCAGCAAATGGAGAT
ACTGTAAGAGGATTTGATGTTATTGACAATATAAAGAGGCAAGTTGATACCGCGTGTGGGCGAAGTGTTGTCTCATGTGCAGACATCCTAGCTATTAGTGCCCGCGACTCCATTATTGAA
GTAAGCCATTCTGATGATACATAATATCAATACTATACCCCTCTCTCTCTCTCTCTCTTTGTTATTAACTAATTACTATCATCTCTTTCTTATTGCTTATATCAGCTTGGAGGACAGAGT
TATTCAGTTCCGCTAGGAAGGAGAGATACAAGAACACCAAACCTTGCGGCAGCAAGAAGTGATCTCCCATCTCCATTTGACCCACTTAATACAATTATTGATAAATTCAGTCGAAAAGGA
TTCAGTGCAAGGGAGATGGTAGCATTATCTGGAGCACACACAGTTGGCCAAGCCCGATGCTCATCTTTCAGAGACCGAATCTACAACGCCACCAACATTGATCCTGACTTTGCAGCAACT
AGACAGGCTAATTGCCCTCGAACTGGTGGAGACAGCAACTTGGCTCCTCTAGACCCTCAAAGCCAAGCTCGGTTTGGCAACAATTACTTCCAAGCATTATTGAACAGAAGAGGTCTACTT
AGTTCTGATCAGGCGTTGTTCAATGGTGGCTCAACGGACTCTATTGTAAGGACATATAGCAACGATGCCAATGCCTTTTTAACAGACTTTACAAATGCCATGGTTAAAATGGGGAATTTG
AGCCCCTTAACTGGTACCCAAGGTGAGATTCGCACTACCTGTCAAAGGGTTAAT

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGACTTCTAGTATTCATCGTACTGTTTTATTAAGTCTTTTTGTGATCTTCCTTACCACCTTTTCATCTCCAGCCCTTGCACAGCTCTCAGTCTCCTTTTATGGTAGTACATGTCCATCA
GTTTTTGACACTGTTAGAGCAGCCACACGCTCGGCTATAAACAGAGAAACTCGAATGGGGGCTTCCATTTTACGTCTTTTCTTCCATGATTGTTTTGTTGGT
GGTTGTAATGGTGGGATT
CTTTTGGCCGGTGGTGAAAGAAATGCACCAGCAAATGGAGATACTGTAAGAGGATTTGATGTTATTGACAATATAAAGAGGCAAGTTGATACCGCGTGTGGGCGAAGTGTTGTCTCATGT
GCAGACATCCTAGCTATTAGTGCCCGCGACTCCATTATTGAA
CTTGGAGGACAGAGTTATTCAGTTCCGCTAGGAAGGAGAGATACAAGAACACCAAACCTTGCGGCAGCAAGAAGTGAT
CTCCCATCTCCATTTGACCCACTTAATACAATTATTGATAAATTCAGTCGAAAAGGATTCAGTGCAAGGGAGATGGTAGCATTATCTGGAGCACACACAGTTGGCCAAGCCCGATGCTCA
TCTTTCAGAGACCGAATCTACAACGCCACCAACATTGATCCTGACTTTGCAGCAACTAGACAGGCTAATTGCCCTCGAACTGGTGGAGACAGCAACTTGGCTCCTCTAGACCCTCAAAGC
CAAGCTCGGTTTGGCAACAATTACTTCCAAGCATTATTGAACAGAAGAGGTCTACTTAGTTCTGATCAGGCGTTGTTCAATGGTGGCTCAACGGACTCTATTGTAAGGACATATAGCAAC
GATGCCAATGCCTTTTTAACAGACTTTACAAATGCCATGGTTAAAATGGGGAATTTGAGCCCCTTAACTGGTACCCAAGGTGAGATTCGCACTACCTGTCAAAGGGTTAAT

Retrieve as FASTA