Entry information : AcoPrx95 (AcoGoldSmith_v1.025965m)
Entry ID 8639
Creation 2011-07-03 (Qiang Li)
Last sequence changes 2011-12-07 (Qiang Li)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2015-10-15 (Christophe Dunand)
Peroxidase information: AcoPrx95 (AcoGoldSmith_v1.025965m)
Name (synonym) AcoPrx95 (AcoGoldSmith_v1.025965m)
Class Class III peroxidase    [Orthogroup: Prx098]
Taxonomy Eukaryota Viridiplantae Streptophyta Ranunculaceae Aquilegia
Organism Aquilegia coerulea     [TaxId: 218851 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value AcoPrx95
start..stop
S start..stop
AfpPrx23 525 0 1..327 1..328
AcoPrx23 525 0 1..327 1..328
AcoPrx63 519 0 1..327 1..327
AcoPrx51 506 0 1..327 1..326
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 1750761..1750988 228 N° 2 1748459..1748653 195 N° 3 1747618..1748175 558  
complement(join(1747618..1748175,1748459..1748653,1750761..1750988))


exon

Literature and cross-references AcoPrx95 (AcoGoldSmith_v1.025965m)
DNA ref. Phytozome 12:   scaffold_2 (1750988..1747618)
Protein sequence: AcoPrx95 (AcoGoldSmith_v1.025965m)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   327 (298)
PWM (Da):   %s   34999.06 (31716.4) Transmb domain:   %s   i12-34o
PI (pH):   %s   4.8 (4.80) Peptide Signal:   %s   cut: 30 range:30-327
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAITSNCSNQYSWFFVLIFFTTISTPVLAQLSVGFYASTCPSVFDTVRTATRSAISAETRMGASLIRLFFHDCFVNGCDGGILLVDTPAVPGEQNTFVNANSVRGYEVIDNIKTQVDRACGSPVVSCADIIAIAARDSVVELGGPSYSIPVGRRDARGPSRAGAMSDLPLANEDLESLLSKFSAKGFNAEEMVALSGTHTVGQARCVVYRNRIYNEANIDPAYATSLQANYTSTSDPASDGNLAPLDPQSPTRFDNNYFHAVINRTTVLSSDQALFNGGATDDIVRGYSNNPTTFSTDFANAMVKMGNLSPLTGTQCEIRRDCKMPN

Retrieve as FASTA  
Remarks Complete sequence from genomic (introns 1 and 2). Incorrect prediction from phytozome (5' end is missing).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTATTACTAGTAATTGTTCAAACCAATACAGTTGGTTTTTTGTTCTCATCTTCTTCACCACAATCTCAACCCCAGTGTTAGCACAACTCTCAGTTGGTTTCTATGCTAGTACATGT
CCTTCAGTATTCGACACTGTCCGTACTGCAACACGGTCTGCCATCAGTGCAGAAACTCGTATGGGGGCATCTCTTATTCGTCTCTTTTTCCATGACTGTTTTGTAAAT
GTAAGTTCTGAT
CCTGTCAGTAATATTTGTTTATCAATGTTTGTAAATATGTGTACCAACTATTTACCACACCCTACATATACATTATATTTCTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAATTAGAAGGATATCCAGATGAAAG
ATTAGGTAGAATAAAAATCATGTAGAACAGTAGAATAAAGGAATTGATTATTATTGTAAATTATAATAATGAGGAATTGAAGAAGCTTATGCAAATTCCAGATCCATTGCTTTCAAAGTG
ATGGATTATGGCTTCAATTGATCAGAATTCTTCATATGATAGCAGAGGCTTGTAGAGATATGTTAAGAAGAGTACCCTATGAGATTAACGCTTTAATGGGTGTTTAATTCGATGAAAAGA
TCATACATTTAACAAAGATCTACAACAATTTGATCTGTTATTAGCTTGTACAGAATTAATTTAGTGGAAAGAAAGTAAATTTCGCTGTCATTGACGAAGTAACTCATTTCAACTTCTCTT
AATTAAATGATGTGTTAGAAACTTAGAATTTTTTTTTATTAAGTAGAAACATAGAATTGGAAACAGAGAAAAAAAAAATCTCTGTAGAAGATGACGGACTTATGGGAGTATAGGGACTCA
CAAAACTTCAATTTAGATTCCCTCATTACAAGCAAGAATAGCTTTAATTTGTGATGTTGTTGGGGGTGGAAGAAGAACTCCCTAGTACATACAGTAGTNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCAGATTTATTAATTATTTCTTTCTATCGCCACTACTGTTATTTATAATTGATATTCATGATAATCGANNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNACAGTAGTACATATGTTAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNATTTCTTATCAATGTTTGCAGGGATGTGATGGAGGGATTCTTTTGGTGGACACACCAGCAGTTCCTGGCGAACAGAATACTTTTGT
TAATGCAAACTCGGTCAGAGGGTATGAGGTGATCGATAACATTAAGACACAGGTTGATAGAGCCTGTGGAAGCCCTGTTGTATCCTGTGCTGACATTATTGCAATTGCAGCTCGTGATTC
TGTTGTGGAA
GTGAGTACTTTACTACTTATTATCGTCTATATAAGATTAGAGAGTTAGAGGAGTATTCTTTACAAGAGTGCTACTGTACTCTGCCCAAGTCGTGAACAAGATGTAACCTT
ATTACCTTAACATAAACATCCATGCACATGTATTAAGAAATGACGATATAAATTAATNNNNNNNNNNNNNNNNNNNNNNNNNNNTAGCTAGATCTCATGTAACATGTGTTATCAAGAAAG
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCACAATTTCTTTGGATGCAACAGCTTGGAGGGCCGTCTTATTCAATCCCAGTAGGAAGAAGAGATGCTAGAGGGCCAAGTAGAGCTGGAG
CCATGAGTGATCTTCCATTAGCTAACGAGGACCTTGAGAGCCTTCTCTCAAAATTCAGTGCTAAAGGATTTAATGCTGAAGAAATGGTTGCACTGTCTGGTACACACACAGTTGGTCAAG
CCCGTTGTGTAGTATATAGAAACCGAATCTACAATGAAGCCAATATTGATCCTGCGTATGCAACATCATTACAGGCTAATTATACGAGTACTTCTGACCCTGCCAGTGATGGCAATTTGG
CTCCTTTAGACCCTCAAAGTCCAACTCGATTTGACAATAATTATTTTCATGCAGTGATCAATAGAACGACAGTTCTTAGTTCTGATCAAGCTCTATTTAATGGTGGAGCAACAGATGATA
TTGTAAGAGGCTATAGCAACAACCCAACAACTTTCTCAACTGATTTCGCAAATGCTATGGTGAAGATGGGGAACTTGAGTCCCTTGACTGGTACCCAATGCGAAATTCGAAGAGATTGTA
AGATGCCCAAT

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTATTACTAGTAATTGTTCAAACCAATACAGTTGGTTTTTTGTTCTCATCTTCTTCACCACAATCTCAACCCCAGTGTTAGCACAACTCTCAGTTGGTTTCTATGCTAGTACATGT
CCTTCAGTATTCGACACTGTCCGTACTGCAACACGGTCTGCCATCAGTGCAGAAACTCGTATGGGGGCATCTCTTATTCGTCTCTTTTTCCATGACTGTTTTGTAAAT
GGATGTGATGGA
GGGATTCTTTTGGTGGACACACCAGCAGTTCCTGGCGAACAGAATACTTTTGTTAATGCAAACTCGGTCAGAGGGTATGAGGTGATCGATAACATTAAGACACAGGTTGATAGAGCCTGT
GGAAGCCCTGTTGTATCCTGTGCTGACATTATTGCAATTGCAGCTCGTGATTCTGTTGTGGAA
CTTGGAGGGCCGTCTTATTCAATCCCAGTAGGAAGAAGAGATGCTAGAGGGCCAAGT
AGAGCTGGAGCCATGAGTGATCTTCCATTAGCTAACGAGGACCTTGAGAGCCTTCTCTCAAAATTCAGTGCTAAAGGATTTAATGCTGAAGAAATGGTTGCACTGTCTGGTACACACACA
GTTGGTCAAGCCCGTTGTGTAGTATATAGAAACCGAATCTACAATGAAGCCAATATTGATCCTGCGTATGCAACATCATTACAGGCTAATTATACGAGTACTTCTGACCCTGCCAGTGAT
GGCAATTTGGCTCCTTTAGACCCTCAAAGTCCAACTCGATTTGACAATAATTATTTTCATGCAGTGATCAATAGAACGACAGTTCTTAGTTCTGATCAAGCTCTATTTAATGGTGGAGCA
ACAGATGATATTGTAAGAGGCTATAGCAACAACCCAACAACTTTCTCAACTGATTTCGCAAATGCTATGGTGAAGATGGGGAACTTGAGTCCCTTGACTGGTACCCAATGCGAAATTCGA
AGAGATTGTAAGATGCCCAAT

Retrieve as FASTA