Entry information : AcoPrx97 (AcoGoldSmith_v1.026800m)
Entry ID 8641
Creation 2011-07-03 (Qiang Li)
Last sequence changes 2011-12-14 (Qiang Li)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2011-12-07 (Qiang Li)
Peroxidase information: AcoPrx97 (AcoGoldSmith_v1.026800m)
Name (synonym) AcoPrx97 (AcoGoldSmith_v1.026800m)
Class Class III peroxidase    [Orthogroup: Prx098]
Taxonomy Eukaryota Viridiplantae Streptophyta Ranunculaceae Aquilegia
Organism Aquilegia coerulea     [TaxId: 218851 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value AcoPrx97
start..stop
S start..stop
AfpPrx23 560 0 1..327 1..328
AcoPrx23 560 0 1..327 1..328
AcoPrx63 546 0 1..327 1..327
AcoPrx101 500 2e-180 11..327 5..319
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 1719546..1719792 247 N° 2 1719223..1719399 177 N° 3 1718550..1719104 555  
complement(join(1718550..1719104,1719223..1719399,1719546..1719792))


exon

Literature and cross-references AcoPrx97 (AcoGoldSmith_v1.026800m)
DNA ref. Phytozome 12:   scaffold_2 (1719792..1718550)
Protein sequence: AcoPrx97 (AcoGoldSmith_v1.026800m)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   327 (302)
PWM (Da):   %s   35539.72 (32657.2) Transmb domain:   %s   i12-30o
PI (pH):   %s   8.55 (8.55) Peptide Signal:   %s   cut: 32 range:26-327
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MEIPSSSKHYNLFLILLIFFSTISTRPxVLAQLSVGFYASTCPSVFDTVRSATRSAINREARMGASLIRLFFHDCFCKCKFHPGCDGGILLVDTPDVPGEQSTLNNANSARGYEVIDNIKTQVDRACGGPVVSCADIWQLQRLGGPSYSIPVGRRDARAPSRAGTSDLPGFNEDLGRLLSKFSAKGFNAQEMVALSGAHTVGQARCAVYRQRIWNDTNIDPAYVESLRANCPRTADSVSDRVLAPLDPQSPNRFGNNYFQALINRRTVLRSDQAIFDGGSTDDIVRGYSNNPTTFSTDFANAMVKMGNLSPLTGTQGEIRRDCKRPN

Retrieve as FASTA  
Remarks Complete sequence from genomic. Incorrect prediction from phytozome (5' end is missing which has been completed).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
GGAAATTCCTAGTAGCTCAAAGCACTACAATTTGTTTTTAATCCTCCTCATCTTCTTCTCCACTATCTCAACCCGGCCCANNGTCTTAGCACAGCTCTCAGTTGGTTTCTATGCTAGTAC
ATGCCCATCAGTATTCGACACTGTCCGTAGTGCAACACGATCTGCCATCAATAGAGAAGCTCGTATGGGAGCGTCTCTTATTCGTCTCTTCTTCCACGACTGTTTTTGTAAATGTAAGTT
TCATCCT
GTTAGTAATATTTGATTTCAGAAGCATACCAACTATATAACACCCTATAAAATCCATTATTTGTGTTTTTTTTTGATAGAAACCATTATTTGTGTTGGTTTTTGTATTGATTT
AATATTAATATTATGCATTAATATTTGATGCAGGGATGTGATGGAGGGATTCTTTTGGTGGACACACCAGACGTCCCCGGCGAACAGAGTACACTGAATAATGCAAACTCAGCCAGAGGG
TATGAGGTGATCGATAACATTAAGACACAGGTTGATAGAGCCTGCGGAGGCCCTGTAGTGTCCTGTGCTGATATTTGGCAATTGCAGCGC
GTGATTCTCTTGTGGAAGTGAGTATTTTTA
ATCCTTTATTAACATCCATGCACATGAAATACAAAGATATAAGAAATAAATGGAATCTAATTGTGTTTTCTTTGGATGCAACGTACAGCTCGGAGGACCGTCTTATTCAATCCCAGTAGG
AAGAAGAGATGCTAGAGCCCCAAGTAGAGCTGGAACCAGTGATCTTCCAGGATTTAACGAGGACCTTGGGAGACTTCTCTCCAAATTTAGTGCTAAAGGATTTAATGCTCAAGAAATGGT
TGCATTGTCTGGTGCACACACAGTTGGTCAAGCCCGATGTGCAGTATATAGACAGCGAATCTGGAACGATACAAATATTGATCCTGCATACGTAGAATCATTACGGGCTAATTGCCCGCG
TACTGCTGACTCTGTCAGTGATAGAGTTTTGGCTCCTTTAGACCCTCAAAGTCCAAATCGATTTGGAAATAATTATTTTCAAGCGTTGATCAATAGAAGGACAGTTCTACGTTCTGATCA
AGCAATATTTGATGGTGGATCAACAGATGATATTGTAAGAGGCTATAGCAATAACCCTACCACTTTCTCAACTGATTTTGCAAATGCTATGGTGAAGATGGGGAACTTGAGTCCCTTGAC
TGGTACCCAAGGCGAAATTCGAAGAGATTGTAAGAGGCCCAAT

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
GGAAATTCCTAGTAGCTCAAAGCACTACAATTTGTTTTTAATCCTCCTCATCTTCTTCTCCACTATCTCAACCCGGCCCANNGTCTTAGCACAGCTCTCAGTTGGTTTCTATGCTAGTAC
ATGCCCATCAGTATTCGACACTGTCCGTAGTGCAACACGATCTGCCATCAATAGAGAAGCTCGTATGGGAGCGTCTCTTATTCGTCTCTTCTTCCACGACTGTTTTTGTAAATGTAAGTT
TCATCCT
GGATGTGATGGAGGGATTCTTTTGGTGGACACACCAGACGTCCCCGGCGAACAGAGTACACTGAATAATGCAAACTCAGCCAGAGGGTATGAGGTGATCGATAACATTAAGAC
ACAGGTTGATAGAGCCTGCGGAGGCCCTGTAGTGTCCTGTGCTGATATTTGGCAATTGCAGCGC
CTCGGAGGACCGTCTTATTCAATCCCAGTAGGAAGAAGAGATGCTAGAGCCCCAAG
TAGAGCTGGAACCAGTGATCTTCCAGGATTTAACGAGGACCTTGGGAGACTTCTCTCCAAATTTAGTGCTAAAGGATTTAATGCTCAAGAAATGGTTGCATTGTCTGGTGCACACACAGT
TGGTCAAGCCCGATGTGCAGTATATAGACAGCGAATCTGGAACGATACAAATATTGATCCTGCATACGTAGAATCATTACGGGCTAATTGCCCGCGTACTGCTGACTCTGTCAGTGATAG
AGTTTTGGCTCCTTTAGACCCTCAAAGTCCAAATCGATTTGGAAATAATTATTTTCAAGCGTTGATCAATAGAAGGACAGTTCTACGTTCTGATCAAGCAATATTTGATGGTGGATCAAC
AGATGATATTGTAAGAGGCTATAGCAATAACCCTACCACTTTCTCAACTGATTTTGCAAATGCTATGGTGAAGATGGGGAACTTGAGTCCCTTGACTGGTACCCAAGGCGAAATTCGAAG
AGATTGTAAGAGGCCCAAT

Retrieve as FASTA