Entry information : CclPrx01 (clementine0.9_015238m)
Entry ID 8647
Creation 2011-06-25 (Qiang Li)
Last sequence changes 2011-10-03 (Qiang Li)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2012-01-05 (Christophe Dunand)
Peroxidase information: CclPrx01 (clementine0.9_015238m)
Name (synonym) CclPrx01 (clementine0.9_015238m)
Class Class III peroxidase    [Orthogroup: Prx001]
Taxonomy Eukaryota Viridiplantae Streptophyta Rutaceae Citrus
Organism Citrus clementina    [TaxId: 85681 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value CclPrx01
start..stop
S start..stop
CsPrx12 692 0 1..335 1..335
PtriPrx01 691 0 1..335 1..335
CppPrx01 691 0 1..335 1..335
MePrx05 618 0 1..332 1..332
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 1044898..1045131 234 N° 2 1045287..1045475 189 N° 3 1045639..1045804 166 N° 4 1045956..1046374 419
join(1044898..1045131,1045287..1045475,1045639..1045804,1045956..1046374)


exon

Literature and cross-references CclPrx01 (clementine0.9_015238m)
Literature Forment,J. et al., Development of a citrus genome-wide EST collection and cDNA microarray as resources for genomic studies, Plant Mol. Biol. 57 (3), 375-391 (2005).
DNA ref. Phytozome 12:   scaffold_19 (1044898..1046374)
Protein sequence: CclPrx01 (clementine0.9_015238m)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   335 (310)
PWM (Da):   %s   37606.33 (35045.9)  
PI (pH):   %s   8.38 (8.02) Peptide Signal:   %s   cut: 26 range:26-335
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MGTKAVFLLLALLSFSAVSLRSALAENEEDPGLVMNFYKDTCPQAEDIIKEQVKLLYKRHKNTAFSWLRNIFHDCAVQSCDASLLLDSTRKTLSEKEMDRSFGMRNFRYIENIKEAVERECPGVVSCADILVLSGRDGVVALGGPYIPLKTGRRDGRKSRAEILEQYLPDHNDSMSVVLERFAAIGIDAPGLVALLGSHSVGRTHCVKLVHRLYPEVDPALNPDHVPHMLHKCPDAIPDPKAVQYVRNDRGTPMVLDNNYYRNILDSKGLMMVDHQLATDKRTRPYVKKMAKSQDYFFKEFSRAITILSENNPLTGTKGEIRKVCNLANKLHDKS

Retrieve as FASTA  
Remarks Complete sequence from genomic. 39 EST sequences. Cultivar "Clemenules".
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGGTACGAAAGCTGTCTTCTTGCTTTTAGCTTTGCTTTCCTTCTCAGCTGTGTCTCTGAGGTCTGCTTTGGCAGAAAATGAAGAGGACCCAGGTCTTGTTATGAATTTTTACAAGGAT
ACATGCCCTCAGGCCGAGGACATTATCAAGGAACAAGTTAAGCTTCTGTACAAGCGCCACAAGAACACTGCATTTTCTTGGCTTAGAAACATTTTCCATGACTGTGCTGTCCAG
GNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCATGCACTCTTTTTAATATTTATTACTTTATTTTACGTGCTCTGTAGATATATGCTGCTAATTAATTGCTTGCTTCCCACCCA
CCCTTCCTTTTCTTTGCATGTTTGCATAGTCTTGTGATGCTTCACTGCTTCTGGACTCGACAAGAAAGACCTTGTCTGAGAAGGAAATGGACAGGAGCTTTGGTATGAGGAACTTCAGGT
ACATTGAGAACATCAAAGAAGCTGTTGAAAGAGAGTGCCCTGGTGTTGTTTCCTGTGCTGATATTCTTGTCCTGTCCGGTAGAGATGGCGTTGTTGCG
GTACACTTTTTTTTCTTTAATT
AACCACCATTTCATCACTCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCACTAGATCTCCAAATGGACAATGGGTATGAGATTTTTCTGAT
GGTGTCTGAAACTTGTTTCAGCTTGGAGGCCCTTACATTCCTCTCAAGACAGGAAGAAGAGATGGTAGAAAAAGCAGAGCAGAGATACTTGAGCAGTATCTCCCAGATCACAATGACAGC
ATGTCTGTTGTTCTTGAGAGGTTTGCAGCCATTGGCATTGACGCCCCTGGACTTGTTGCTCTGCTAG
GTAATTTTTTTTTTCCCCTTAATCTATGCTTCGATTACGACTATTAAGCATAT
AACGACCGAGTTTCTTAAACTTTAAAAAGAAGTAATTTAAGATTATTTATAATAACAATTATTAGGTCTTAATTACTACTGTTGGTCTATTTCATCAGGATCTCACAGTGTTGGCAGAAC
TCATTGTGTGAAGCTGGTGCACCGTCTGTACCCAGAAGTTGACCCTGCACTGAACCCTGACCACGTTCCGCATATGCTCCATAAGTGTCCTGATGCAATCCCAGACCCCAAGGCTGTTCA
GTATGTGAGGAATGACCGTGGCACACCCATGGTGCTGGACAACAACTACTATAGGAACATATTGGACAGCAAGGGCTTGATGATGGTTGATCATCAGCTAGCCACCGACAAGAGGACAAG
ACCTTATGTTAAGAAGATGGCCAAGAGTCAAGACTACTTCTTCAAGGAATTTTCAAGAGCCATTACTATCCTTTCTGAGAACAACCCTCTCACCGGTACAAAGGGTGAGATCAGAAAGGT
TTGCAATCTTGCCAACAAGCTCCACGACAAGTCCTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGGTACGAAAGCTGTCTTCTTGCTTTTAGCTTTGCTTTCCTTCTCAGCTGTGTCTCTGAGGTCTGCTTTGGCAGAAAATGAAGAGGACCCAGGTCTTGTTATGAATTTTTACAAGGAT
ACATGCCCTCAGGCCGAGGACATTATCAAGGAACAAGTTAAGCTTCTGTACAAGCGCCACAAGAACACTGCATTTTCTTGGCTTAGAAACATTTTCCATGACTGTGCTGTCCAG
TCTTGT
GATGCTTCACTGCTTCTGGACTCGACAAGAAAGACCTTGTCTGAGAAGGAAATGGACAGGAGCTTTGGTATGAGGAACTTCAGGTACATTGAGAACATCAAAGAAGCTGTTGAAAGAGAG
TGCCCTGGTGTTGTTTCCTGTGCTGATATTCTTGTCCTGTCCGGTAGAGATGGCGTTGTTGCG
CTTGGAGGCCCTTACATTCCTCTCAAGACAGGAAGAAGAGATGGTAGAAAAAGCAGA
GCAGAGATACTTGAGCAGTATCTCCCAGATCACAATGACAGCATGTCTGTTGTTCTTGAGAGGTTTGCAGCCATTGGCATTGACGCCCCTGGACTTGTTGCTCTGCTAG
GATCTCACAGT
GTTGGCAGAACTCATTGTGTGAAGCTGGTGCACCGTCTGTACCCAGAAGTTGACCCTGCACTGAACCCTGACCACGTTCCGCATATGCTCCATAAGTGTCCTGATGCAATCCCAGACCCC
AAGGCTGTTCAGTATGTGAGGAATGACCGTGGCACACCCATGGTGCTGGACAACAACTACTATAGGAACATATTGGACAGCAAGGGCTTGATGATGGTTGATCATCAGCTAGCCACCGAC
AAGAGGACAAGACCTTATGTTAAGAAGATGGCCAAGAGTCAAGACTACTTCTTCAAGGAATTTTCAAGAGCCATTACTATCCTTTCTGAGAACAACCCTCTCACCGGTACAAAGGGTGAG
ATCAGAAAGGTTTGCAATCTTGCCAACAAGCTCCACGACAAGTCCTAG

Retrieve as FASTA