Entry information : CclPrx03 (clementine0.9_015076m)
Entry ID 8650
Creation 2011-06-25 (Qiang Li)
Last sequence changes 2011-10-03 (Qiang Li)
Sequence status complete
Reviewer Qiang Li
Last annotation changes 2012-01-04 (Qiang LI)
Peroxidase information: CclPrx03 (clementine0.9_015076m)
Name (synonym) CclPrx03 (clementine0.9_015076m)
Class Class III peroxidase    [Orthogroup: Prx014]
Taxonomy Eukaryota Viridiplantae Streptophyta Rutaceae Citrus
Organism Citrus clementina    [TaxId: 85681 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value CclPrx03
start..stop
S start..stop
CsPrx34 698 0 1..338 1..338
CppPrx12 684 0 1..338 1..338
MePrx130 482 5e-173 10..328 5..322
RcPrx88 476 7e-171 9..329 3..322
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 5297814..5298035 222 N° 2 5298151..5298342 192 N° 3 5298578..5298746 169 N° 4 5298863..5299296 434
join(5297814..5298035,5298151..5298342,5298578..5298746,5298863..5299296)


exon

Literature and cross-references CclPrx03 (clementine0.9_015076m)
Literature Forment,J. et al., Development of a citrus genome-wide EST collection and cDNA microarray as resources for genomic studies, Plant Mol. Biol. 57 (3), 375-391 (2005).
DNA ref. Phytozome 12:   scaffold_3 (5297814..5299296)
Protein sequence: CclPrx03 (clementine0.9_015076m)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   339 (312)
PWM (Da):   %s   36972.74 (34331.3) Transmb domain:   %s   i7-29o
PI (pH):   %s   7.9 (7.41) Peptide Signal:   %s   cut: 27 range:27-338
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MKKAAGAGSLLLVCLVVFGIIGVCQGGELRKNFYRDSCKSAEDIVRSITWKNAASNPDLPAKLIRMHFHDCFVRGCDASVLINSTAGNKAERDAVPNLSLGGFEVINEIKSELESRCPGIVSCADIVALATRDSVSFQFQKPDLWEVLTGRRDGSVSIAAEADLLLPSPFANFSELKKNFNDKGLTVKDLVVLSGGHTIGVSHCTFFSNRLYNFTGNGDQDPSLDPRYAAFLKTKCKSLADTTTTAELDPGSFRKFDSHYYDILIENKGLFQSDAALLTNKGARNIVMELRNQDKFFTEFAQSMKRMGAMNVLTGTQGEIRKKCSVINNPDSLLHSSI*

Retrieve as FASTA  
Remarks Complete sequence from genomic. 5 ESTs. Assembly by PeroxiBase Team.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAAGAAAGCCGCTGGGGCTGGGTCTCTTTTGTTAGTTTGCTTAGTAGTTTTTGGTATTATAGGGGTTTGCCAAGGAGGTGAGCTAAGGAAGAATTTCTACAGGGACAGCTGTAAATCT
GCTGAAGATATCGTCAGGAGCATCACCTGGAAAAATGCCGCCAGTAACCCTGACTTGCCGGCCAAGCTTATCAGAATGCATTTCCATGACTGCTTTGTTAGG
GTAATTCAATACTACAGC
TAATTAGCTTCAACGTCAAAATTATTTGATCGATGCACGCGCGCTTCTATATTACATTGAGCCATCTAATTAACTTGTGACTAACTTATTTCTGCAGGGTTGCGATGCGTCGGTTTTGAT
AAACTCAACTGCAGGTAACAAAGCAGAGAGGGATGCAGTTCCGAATCTATCTTTGGGAGGTTTCGAAGTTATTAATGAGATTAAATCGGAGCTCGAGAGCAGGTGTCCAGGAATTGTTTC
TTGTGCCGATATCGTAGCATTGGCTACAAGGGATTCTGTTTCATTCCAA
GTAAGTTTAGTTACGTTAATCAGCTAAATCTCCTTTGAACATGTGCGTGTGTATTGTACGTGTCTATGAAA
TCTTATTATGCGGATCAAGCTAAAAATAGACAAATACCAACTCTAATAATCTACTGAAAGGATGAAAAAACACTGCTTCATTTCCTTGTCTTTTTAGCTTGGTCATCAGTTTATTGAAAC
GACGGAGATTTGTCTATATGAATATTGTGCCATAACATTTGCAGTTTCAAAAACCGGACCTGTGGGAAGTGCTCACCGGTAGAAGAGATGGCAGTGTGTCCATAGCTGCTGAGGCCGATC
TGCTGCTTCCTTCACCTTTTGCCAACTTCAGTGAACTCAAGAAAAATTTTAACGACAAAGGTCTCACTGTCAAAGATCTTGTAGTCCTTTCAG
GTATGCNNNNNNNNNNNNNNNNNNNNN
NNNCCGCACCAATTTTACAACTAATTTAAGTAAATAACAAAGATGTAACCATGCTTCACATCTAATTAATTTGCATTTATTAATCTAAGGTGGCCACACAATCGGAGTTTCGCACTGCAC
CTTCTTCAGCAACAGGCTCTACAATTTCACAGGAAATGGAGATCAAGATCCTTCATTGGACCCACGATACGCTGCATTCTTAAAAACCAAATGCAAGAGCCTTGCCGACACAACGACTAC
TGCCGAATTGGACCCGGGGAGTTTTCGAAAATTCGACAGCCATTACTATGATATTCTTATCGAGAACAAGGGTCTATTCCAATCTGATGCTGCTCTTTTAACCAATAAGGGAGCAAGAAA
CATTGTCATGGAGTTGAGAAACCAAGATAAGTTCTTCACCGAGTTTGCTCAGTCAATGAAGAGAATGGGAGCTATGAATGTTCTCACTGGCACTCAAGGGGAGATTCGAAAGAAGTGCAG
TGTTATTAATAATCCAGATAGTTTGTTGCATTCATCTATCTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAAGAAAGCCGCTGGGGCTGGGTCTCTTTTGTTAGTTTGCTTAGTAGTTTTTGGTATTATAGGGGTTTGCCAAGGAGGTGAGCTAAGGAAGAATTTCTACAGGGACAGCTGTAAATCT
GCTGAAGATATCGTCAGGAGCATCACCTGGAAAAATGCCGCCAGTAACCCTGACTTGCCGGCCAAGCTTATCAGAATGCATTTCCATGACTGCTTTGTTAGG
GGTTGCGATGCGTCGGTT
TTGATAAACTCAACTGCAGGTAACAAAGCAGAGAGGGATGCAGTTCCGAATCTATCTTTGGGAGGTTTCGAAGTTATTAATGAGATTAAATCGGAGCTCGAGAGCAGGTGTCCAGGAATT
GTTTCTTGTGCCGATATCGTAGCATTGGCTACAAGGGATTCTGTTTCATTCCAA
TTTCAAAAACCGGACCTGTGGGAAGTGCTCACCGGTAGAAGAGATGGCAGTGTGTCCATAGCTGCT
GAGGCCGATCTGCTGCTTCCTTCACCTTTTGCCAACTTCAGTGAACTCAAGAAAAATTTTAACGACAAAGGTCTCACTGTCAAAGATCTTGTAGTCCTTTCAG
GTGGCCACACAATCGGA
GTTTCGCACTGCACCTTCTTCAGCAACAGGCTCTACAATTTCACAGGAAATGGAGATCAAGATCCTTCATTGGACCCACGATACGCTGCATTCTTAAAAACCAAATGCAAGAGCCTTGCC
GACACAACGACTACTGCCGAATTGGACCCGGGGAGTTTTCGAAAATTCGACAGCCATTACTATGATATTCTTATCGAGAACAAGGGTCTATTCCAATCTGATGCTGCTCTTTTAACCAAT
AAGGGAGCAAGAAACATTGTCATGGAGTTGAGAAACCAAGATAAGTTCTTCACCGAGTTTGCTCAGTCAATGAAGAGAATGGGAGCTATGAATGTTCTCACTGGCACTCAAGGGGAGATT
CGAAAGAAGTGCAGTGTTATTAATAATCCAGATAGTTTGTTGCATTCATCTATCTGA

Retrieve as FASTA