Entry information : CclPrx09 (clementine0.9_009253m)
Entry ID 8659
Creation 2011-06-25 (Qiang Li)
Last sequence changes 2012-01-03 (Qiang Li)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2012-01-04 (Qiang LI)
Peroxidase information: CclPrx09 (clementine0.9_009253m)
Name (synonym) CclPrx09 (clementine0.9_009253m)
Class Class III peroxidase    [Orthogroup: Prx022]
Taxonomy Eukaryota Viridiplantae Streptophyta Rutaceae Citrus
Organism Citrus clementina    [TaxId: 85681 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value CclPrx09
start..stop
S start..stop
CsPrx02 576 0 1..293 1..293
CsPrx02 194 5e-58 371..464 286..379
MePrx84 477 2e-167 2..464 11..421
RcPrx65 461 2e-161 59..462 26..400
LePrx106 437 4e-152 3..462 5..413
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 1256720..1257088 369 N° 2 1257610..1257798 189 N° 3 1257894..1258059 166 N° 4 1259707..1260377 671
join(1256720..1257088,1257610..1257798,1257894..1258059,1259707..1260377)


exon

Literature and cross-references CclPrx09 (clementine0.9_009253m)
DNA ref. Phytozome 12:   scaffold_33 (1256720..1260377)
Protein sequence: CclPrx09 (clementine0.9_009253m)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   464 (441)
PWM (Da):   %s   49903.61 (47193.2)  
PI (pH):   %s   4.75 (4.58) Peptide Signal:   %s   cut: 24 range:24-464
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MMRRVSFLVFLLCIVISFKNQNADTKKGLNITTTSTTSRSFSYEYAASDPSAFQVVAGALFLSDDGKLEEGGEPYRSMEYDFYRDSCPQAEGTIRAMVRYLHKSRSDVAPALLRLVFHDCFIEGCDASILLDDAEGVDSEKKSPPNESLKGYDVINIIKEELEEICPGVVSCADILALAAREGVVLAGGPFYPLYTGRKDSRLAFADIATLELPSPNADLSETLASFASRGFDLRETVTLLGAHSIGVIHCKFFNNRLHNFGRSNEPDPSLDPDFLNLLRSKCRNISSTSPTPSPPFADSPSSSAAPSADFDGSVSSSSAPSPNFDGSFSSSAAPSPNFNGSPKSTTALSPAFDASPSSPTASIFSLEALLASTFDEPGINVTYDGHQGGFGTVYYRSLLQNRGVLYADQQLMAGEETGIWVRAYASDVSLFRRDFALAMMKLSNLRVLTGPMGQIRLNCSKGA

Retrieve as FASTA  
Remarks Complete sequence from genomic. Incorrect prediction from phytozome (Major prob of prediction: 100 extra aa after VALS, 1 3'EST confirmed this extra seq, but all other EST stop just after the VALS!!!!!)
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGATGCGAAGGGTGAGCTTCCTCGTGTTCCTTCTGTGCATCGTGATCTCTTTCAAGAACCAAAACGCCGATACCAAGAAAGGCTTAAACATCACCACTACGAGCACTACCTCGCGTTCT
TTTTCTTATGAGTATGCGGCGTCGGATCCTTCTGCGTTTCAGGTAGTGGCTGGGGCCCTGTTCTTGTCCGATGACGGGAAACTTGAAGAAGGTGGCGAGCCTTACCGTTCTATGGAGTAC
GATTTTTACCGCGATTCTTGCCCGCAAGCCGAGGGTACTATTCGGGCTATGGTCCGGTATCTCCACAAATCCCGCTCCGATGTCGCCCCCGCTTTGTTGCGCCTCGTTTTCCATGATTGC
TTCATTGAG
GTCCAGTTTTCTTCAATCAATTCTTGTTGTGTTTTTTATTGGTTTTAGTGCTAAGCGTTTCATTTCTTGTTGGATATCAACCTAATCGGATGTTGATTTTGATGTGAATTT
ATTATATCTTGATACTTGATCTTTACTATAATGTTGGTGAATATCTCATCGGACGTCGAGTTTGATCAGTGTTTGGTTATTTGATTTTGATGTGAATTTGTTGAACCTTGGATATTTAAT
CTGGGTTTTGTTGAATTTTGTAGTTCGTTTGCTTCTTGTTATTTTCCATATAATTTACTAGCTCTTTGCTAGTTGGATCTGGGTCATTGATTACTTAGTTTCATCCACTGTTATACAATC
TCCAAACAATCTAGTTTATTCTGATAATCTTTCAGTAGGGTTATCTGATTTATTCACAGTTTGATCTGGGTTTAGCAATTATCTAATGCGTATTTTTGTTGATTGGGTTGTTCTTACGTC
AGTCTGATTGATTTTGAGTTGAATTTCTCTGTAATTTGGAAATTGATTAGGGTTGTGATGCTTCAATTCTACTGGATGATGCTGAAGGAGTGGACTCGGAGAAAAAGTCTCCACCCAATG
AATCTCTCAAGGGCTACGATGTAATCAACATAATCAAGGAGGAGCTTGAAGAAATATGCCCTGGTGTGGTTTCATGTGCAGATATTCTTGCTTTGGCTGCCAGAGAAGGCGTTGTTCTG
G
TAAATTCCTGTCTCATGTGACTACTCAAACTTTATTAAATCAGGCTCTACCTTTATATAATTTGTTTAGATAATCATTTTGTCCATGAATTTAGGCTGGTGGTCCATTCTATCCACTGTA
TACTGGAAGGAAGGACAGTAGGCTTGCTTTCGCGGATATAGCAACACTTGAGCTTCCTTCACCCAATGCTGATCTGTCCGAAACCCTTGCATCTTTTGCATCAAGGGGGTTTGATTTAAG
AGAAACTGTTACTCTATTGG
GTATAGATTTCCTTATTTCATTTCATTTCCCTTTTTCCTTTCATGAAAAAGTAGAAATTTCTGATTTCAGTTTGTATTGAATTTACTCTTGAATTTTTTT
TTTTTTTTTTGGTTATTTCTGCGTTTGAGCTGATTGTCTGATAGTCTTGTTCTGATCTCTTTTGTTCATAATTTGATGTACTAGAGAGGACAATATTTCCACCTAATTCTACAGTTTAGC
TTAGTAGAGGTGTCTTATTTTCCTTCTCATTTGTACTACCTTTTATTTCCTATTCCTTGGTACTCAAATTAGAATATTCTTATCATTATCAATCCTTCATTATGTTATGATACGGATGGT
AATACCTTACTAGGGATGGCAATNNNNNNNNNNNNNNNNNNNNCCAATCTCCCCATACCCATCCCCGATGTTTTGCATATGTCCCCGTCCCCTCCCCGTCCCCGTCAAAATTGCTTGAGA
GAATCTCCATCCCCTCCCCGAATAATAACAGGGGATCCCCGAGGGTCCCCGGTCCCCGAATAATTAATAGTCTAATACATTTTTTATTTTCGATTTTAAATTAATCATATNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNATCTGCAACAACTGCACAATCTCCATTGTTTACATAATCATTAAAACCTGTCATCCATTTGGTTGCTTTCTTATAAGAATCCCCTGTAG
ATCTAGTAGAAGAACTACTACCAGTATAATCAAAGCAATAAACAGTTGGTGAAAACTTCAATTAATACTCTTCAACTAATTCCCGGCAAAGGGTGACCACTTTCCCAACATACAACTATT
TTGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGTAATTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGGGAAATGGGTAGGGGATGGGGATTCCACC
TCATCCCCGTCCCCTCCCCGAATAAAAAGTTGGGTAAAAAATTTTCCCCGTCCCCTCCCCGAAAAAAAAATTGGGTATAAAATTATCCCCGTACCCTCCCCGAATGGGGAAAATCCCCGA
GGGTACCCATCCCCGTGGGGATTTTTGCCATCCCTATACCTTACACCTAGTATGATGACTTTTCTCTTAGAATGTATTGATTGGTCCTTGATTGGTGATTTTGTACTACAGATTATTCCT
TTCTACCTAACAGTTTGTGCTTGTGATAACCTGATCCGAGTATTTAATTTCATAAATATTCAAGGAAATTTGTTCAGAGATTTCTTAGATTCCTAACCTTGTTATGGTTCAGTTTTATGA
TGATAACCAGTTTTGATCTGTGATTGTGGTCGTTTCCAGCCTCCTAGCTGTTTAACTGTCTATTCTAAGTAATGTAATTTGATTATTTCTTCTTTCTTTGTTTGCAGGTGCCCATAGCAT
TGGTGTTATCCACTGCAAATTCTTCAACAATCGTCTGCATAACTTCGGCCGGAGTAATGAACCTGACCCATCTCTGGATCCTGATTTTCTGAACCTACTGAGATCAAAATGCAGAAACAT
TTCATCAACATCGCCAACACCCTCACCTCCCTTTGCTGACTCCCCATCATCATCGGCAGCTCCATCAGCTGACTTTGATGGCTCAGTTTCTTCTTCATCAGCTCCCTCACCTAACTTCGA
TGGCTCATTTTCCTCATCAGCAGCTCCATCACCAAACTTCAATGGCTCACCAAAATCAACAACAGCTTTATCACCTGCCTTTGATGCCTCACCCTCATCACCCACAGCATCAATATTTTC
GTTGGAGGCCTTGTTAGCTTCAACATTTGACGAACCTGGAATAAATGTGACTTATGATGGACATCAAGGAGGTTTCGGCACTGTGTACTATCGCAGTCTTTTGCAGAATAGAGGAGTTCT
CTATGCTGATCAGCAGCTTATGGCCGGCGAAGAAACTGGGATCTGGGTGAGAGCATATGCTTCAGATGTCTCCTTGTTTCGCAGAGACTTTGCCTTGGCCATGATGAAGCTCTCAAATCT
CCGAGTCTTGACAGGACCAATGGGCCAGATCCGTCTTAATTGTTCAAAAGGGGCATAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGATGCGAAGGGTGAGCTTCCTCGTGTTCCTTCTGTGCATCGTGATCTCTTTCAAGAACCAAAACGCCGATACCAAGAAAGGCTTAAACATCACCACTACGAGCACTACCTCGCGTTCT
TTTTCTTATGAGTATGCGGCGTCGGATCCTTCTGCGTTTCAGGTAGTGGCTGGGGCCCTGTTCTTGTCCGATGACGGGAAACTTGAAGAAGGTGGCGAGCCTTACCGTTCTATGGAGTAC
GATTTTTACCGCGATTCTTGCCCGCAAGCCGAGGGTACTATTCGGGCTATGGTCCGGTATCTCCACAAATCCCGCTCCGATGTCGCCCCCGCTTTGTTGCGCCTCGTTTTCCATGATTGC
TTCATTGAG
GGTTGTGATGCTTCAATTCTACTGGATGATGCTGAAGGAGTGGACTCGGAGAAAAAGTCTCCACCCAATGAATCTCTCAAGGGCTACGATGTAATCAACATAATCAAGGAG
GAGCTTGAAGAAATATGCCCTGGTGTGGTTTCATGTGCAGATATTCTTGCTTTGGCTGCCAGAGAAGGCGTTGTTCTG
GCTGGTGGTCCATTCTATCCACTGTATACTGGAAGGAAGGAC
AGTAGGCTTGCTTTCGCGGATATAGCAACACTTGAGCTTCCTTCACCCAATGCTGATCTGTCCGAAACCCTTGCATCTTTTGCATCAAGGGGGTTTGATTTAAGAGAAACTGTTACTCTA
TTGG
GTGCCCATAGCATTGGTGTTATCCACTGCAAATTCTTCAACAATCGTCTGCATAACTTCGGCCGGAGTAATGAACCTGACCCATCTCTGGATCCTGATTTTCTGAACCTACTGAGA
TCAAAATGCAGAAACATTTCATCAACATCGCCAACACCCTCACCTCCCTTTGCTGACTCCCCATCATCATCGGCAGCTCCATCAGCTGACTTTGATGGCTCAGTTTCTTCTTCATCAGCT
CCCTCACCTAACTTCGATGGCTCATTTTCCTCATCAGCAGCTCCATCACCAAACTTCAATGGCTCACCAAAATCAACAACAGCTTTATCACCTGCCTTTGATGCCTCACCCTCATCACCC
ACAGCATCAATATTTTCGTTGGAGGCCTTGTTAGCTTCAACATTTGACGAACCTGGAATAAATGTGACTTATGATGGACATCAAGGAGGTTTCGGCACTGTGTACTATCGCAGTCTTTTG
CAGAATAGAGGAGTTCTCTATGCTGATCAGCAGCTTATGGCCGGCGAAGAAACTGGGATCTGGGTGAGAGCATATGCTTCAGATGTCTCCTTGTTTCGCAGAGACTTTGCCTTGGCCATG
ATGAAGCTCTCAAATCTCCGAGTCTTGACAGGACCAATGGGCCAGATCCGTCTTAATTGTTCAAAAGGGGCATAA

Retrieve as FASTA