Entry information : CclPrx100 (clementine0.9_030823m)
Entry ID 8661
Creation 2011-06-25 (Qiang Li)
Last sequence changes 2011-10-03 (Qiang Li)
Sequence status partial
Reviewer Qiang Li
Last annotation changes 2012-01-04 (Qiang LI)
Peroxidase information: CclPrx100 (clementine0.9_030823m)
Name (synonym) CclPrx100 (clementine0.9_030823m)
Class Class III peroxidase     [Orthogroup: Prx031]*
Taxonomy Eukaryota Viridiplantae Streptophyta Rutaceae Citrus
Organism Citrus clementina    [TaxId: 85681 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value CclPrx100
start..stop
S start..stop
CsPrx60 624 0 1..299 62..360
MtPrx18 429 7e-153 3..298 42..335
PpePrx49 429 9e-153 2..296 42..335
GmPrx167 423 3e-150 3..296 47..338
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 6598055..6598195 141 N° 2 6596786..6597544 759  
complement(join(6596786..6597544,6598055..6598195))


exon

Literature and cross-references CclPrx100 (clementine0.9_030823m)
DNA ref. Phytozome 12:   scaffold_6 (6598195..6596786)
Protein sequence: CclPrx100 (clementine0.9_030823m)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   299
PWM (Da):   %s   32977.08  
PI (pH):   %s   9.6
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
YLSLSHYHSTCPDLEGIIHRQVQAWIRKDYTFAASLIRLHFHDCVVRGCDASILLSHKGSERRAKVSKTLRGFRIIDEIKAEVEKKCPKTVSCADILTAAARDATVVAGGPFWEVPFGRKDGKISSAREANRLVPQGHENVTTLIQIFRDHGLNILDLVVLSGAHTIGRSSCDAINHRLHNFNGTRKADPSLDTKYLNSLKKKCAASSHVYVDLDATTPRIFDTAYYTNLGRNMGLLSTDQLLNSDARTGPFVSVLASQPLVFSSQFAASMVKLGNIGVLARPNEGEIRFKCSSVNRAY*

Retrieve as FASTA  
Remarks Partial sequence from genomic. Incorrect prediction from phytozome (5' end is missing which can not be found in genomic).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
TACTTGTCTTTGAGTCACTATCATTCAACATGTCCAGATCTTGAAGGCATCATCCACCGCCAAGTGCAAGCCTGGATTAGGAAGGACTACACATTCGCTGCCAGCCTCATCCGCCTCCAC
TTCCATGACTGTGTTGTTAGG
GTAAGCTAATTTCATTTACATATTACTCTAAATTACTCTTACTCTTACTCACCCAATTGATACATAATTAATTGTTTCAAGTTTCAATTGNNNNNNNNN
NNNNNNNNNNNNNNNNNNNGTTACACAAGCAGCACAATCCAAGATCAATTTATACGTAGTAATGATTCAGTGGATATATGAAATAATTACCTACAGCTGGTTAATTTACATACTACATAC
TTATTATTTTAACCTATATATACAGTTAATTTTTACCTTCAAGTTTAACAGTTTTTCATTCAATTCTGACTCCATCCTTGATTTTTCTCGTGCAACTAGTAAACCATAGGCNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNCATACCGTTCTCTCCTTCTTAGTTAATTATGTCATTACTGTTCTTTATGTTATGCTGTCTCCGTTAATTATCTATGACCCCCATCGAACCAAAATGATT
AGTAATATGTGTGTGTCTGTGTGTGTATATAAAATATGTTTGATGCTGCAGGGTTGTGATGCTTCAATATTGCTGAGCCATAAAGGCAGCGAAAGGAGAGCCAAGGTGAGCAAGACACTG
AGAGGCTTCAGAATCATCGATGAGATCAAGGCTGAGGTTGAGAAGAAATGCCCTAAAACTGTATCATGTGCTGACATTCTGACAGCAGCAGCTAGAGATGCAACAGTAGTAGCCGGAGGC
CCATTCTGGGAAGTCCCGTTTGGCCGAAAAGACGGAAAGATTTCCAGTGCAAGAGAAGCAAATCGCCTTGTTCCTCAGGGACACGAAAATGTCACAACTTTGATCCAAATTTTCCGAGAT
CATGGCTTGAACATTCTTGACCTGGTCGTCCTCTCAGGGGCACATACTATTGGCAGAAGCTCTTGCGACGCCATAAATCATAGGCTCCATAACTTCAATGGTACGCGAAAAGCTGATCCT
TCACTTGATACAAAGTATTTGAACTCGTTGAAGAAAAAATGTGCTGCTAGCAGTCATGTCTATGTTGATCTTGATGCAACAACGCCTAGGATTTTCGACACAGCTTATTACACCAATCTT
GGGAGGAATATGGGATTGTTATCGACCGATCAACTGTTGAATTCTGATGCAAGAACTGGACCATTTGTTTCAGTACTGGCCTCTCAGCCATTAGTTTTCTCCTCCCAATTTGCGGCGTCA
ATGGTCAAACTTGGTAACATTGGAGTGCTCGCTCGCCCCAACGAAGGTGAAATCAGATTCAAGTGCAGTTCTGTCAATCGAGCTTATTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
TACTTGTCTTTGAGTCACTATCATTCAACATGTCCAGATCTTGAAGGCATCATCCACCGCCAAGTGCAAGCCTGGATTAGGAAGGACTACACATTCGCTGCCAGCCTCATCCGCCTCCAC
TTCCATGACTGTGTTGTTAGG
GGTTGTGATGCTTCAATATTGCTGAGCCATAAAGGCAGCGAAAGGAGAGCCAAGGTGAGCAAGACACTGAGAGGCTTCAGAATCATCGATGAGATCAAG
GCTGAGGTTGAGAAGAAATGCCCTAAAACTGTATCATGTGCTGACATTCTGACAGCAGCAGCTAGAGATGCAACAGTAGTAGCCGGAGGCCCATTCTGGGAAGTCCCGTTTGGCCGAAAA
GACGGAAAGATTTCCAGTGCAAGAGAAGCAAATCGCCTTGTTCCTCAGGGACACGAAAATGTCACAACTTTGATCCAAATTTTCCGAGATCATGGCTTGAACATTCTTGACCTGGTCGTC
CTCTCAGGGGCACATACTATTGGCAGAAGCTCTTGCGACGCCATAAATCATAGGCTCCATAACTTCAATGGTACGCGAAAAGCTGATCCTTCACTTGATACAAAGTATTTGAACTCGTTG
AAGAAAAAATGTGCTGCTAGCAGTCATGTCTATGTTGATCTTGATGCAACAACGCCTAGGATTTTCGACACAGCTTATTACACCAATCTTGGGAGGAATATGGGATTGTTATCGACCGAT
CAACTGTTGAATTCTGATGCAAGAACTGGACCATTTGTTTCAGTACTGGCCTCTCAGCCATTAGTTTTCTCCTCCCAATTTGCGGCGTCAATGGTCAAACTTGGTAACATTGGAGTGCTC
GCTCGCCCCAACGAAGGTGAAATCAGATTCAAGTGCAGTTCTGTCAATCGAGCTTATTAA

Retrieve as FASTA