Entry information : CclPrx103 (clementine0.9_031837m)
Entry ID 8664
Creation 2011-06-25 (Qiang Li)
Last sequence changes 2011-10-03 (Qiang Li)
Sequence status complete
Reviewer Qiang Li
Last annotation changes 2012-01-04 (Qiang LI)
Peroxidase information: CclPrx103 (clementine0.9_031837m)
Name (synonym) CclPrx103 (clementine0.9_031837m)
Class Class III peroxidase    [Orthogroup: Prx012]
Taxonomy Eukaryota Viridiplantae Streptophyta Rutaceae Citrus
Organism Citrus clementina    [TaxId: 85681 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value CclPrx103
start..stop
S start..stop
CclPrx97 638 0 1..323 1..323
CsPrx23 632 0 1..323 1..323
CclPrx117 598 0 1..323 1..323
CclPrx85 589 0 1..323 1..317
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 1076822..1077241 420 N° 2 1076504..1076666 163 N° 3 1075967..1076355 389  
complement(join(1075967..1076355,1076504..1076666,1076822..1077241))


exon

Literature and cross-references CclPrx103 (clementine0.9_031837m)
DNA ref. Phytozome 12:   scaffold_15 (1077241..1075967)
Protein sequence: CclPrx103 (clementine0.9_031837m)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   323 (294)
PWM (Da):   %s   34779.51 (31544.9)  
PI (pH):   %s   8.32 (8.40) Peptide Signal:   %s   cut: 30 range:30-323
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MASLYQTNKFTCTIIVSMFLLIISTQSEAQLSPTFYDATCPSALNTIRTGIRNAVSRERRMSASLIRLHFHDCFVQGCDASILLDDSSSIDSEKNALPNFKSARGFEVIDSVKSQLERVCPGVVSCADIVAVAARDASFAVGGPSWRVKLGRRDSTTASRSLAENLPSFTDGLDKLISTFATKGLNARDLVALSGAHTIGQAQCAFFRDRIYSNQSNIDAGFASTRRRQCPANGGDSNLSPLDLVTPNSFDNNYFKNLIQKKGLLASDQVLFSGGSTDSIVDEYSKNPSKFKSDFAAAMIKMADISPLTGSAGEIRRVCNLVN

Retrieve as FASTA  
Remarks Complete sequence from genomic. Incorrect prediction from phytozome(Short 5' end is missing which has been completed).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTTCTCTTTATCAAACAAATAAGTTCACGTGTACAATTATTGTCTCCATGTTTTTGTTGATCATCTCTACGCAATCTGAAGCACAACTCTCACCAACATTTTACGATGCCACTTGC
CCAAGTGCCCTCAACACAATCCGAACAGGCATTAGAAATGCTGTTTCACGAGAGCGTAGGATGTCGGCATCCCTCATTCGCCTCCATTTTCATGATTGCTTCGTTCAAGGTTGTGACGCG
TCCATTTTGTTGGACGATTCCTCCTCCATTGACAGCGAGAAAAATGCACTTCCAAATTTTAAATCAGCTAGAGGGTTCGAAGTTATAGATAGTGTCAAGTCTCAACTGGAGAGAGTTTGC
CCTGGAGTTGTTTCATGCGCTGATATCGTTGCTGTTGCAGCCCGTGATGCTTCTTTTGCT
GTGAGTAAATCATCATTAATTTTCTACAAGATTAATACAATAAGAGACATGGTAACAGAA
ATAGTGATAAGCCGATACCGTTCTGTATTAATAATCTTAATATATAATTCATTGTTAGTTTTGGTTAGNNNNNNNNNNNNNNNNNNNNNNNNCAGGTTGGTGGACCATCATGGAGAGTTA
AGCTTGGTCGAAGAGACTCAACAACTGCAAGCAGAAGCTTAGCAGAAAACCTCCCCAGCTTTACAGATGGATTGGACAAACTTATTTCCACCTTCGCTACCAAAGGCTTGAATGCAAGAG
ACTTGGTTGCCCTTTCAG
GTACCCCTCTCTCCCTACATACATACATACATATGTGTGTGTGTATTTGTCACGCCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNGTAATTTCATTTGAAATTCAGGAGCTCATACAATTGGCCAAGCACAGTGTGCATTTTTCCGTGATAGGATTTATAGCAATCAAAGCAATATTGAT
GCTGGATTCGCGAGCACTCGTAGACGTCAGTGTCCGGCTAATGGTGGTGACAGCAATCTATCACCACTTGATTTAGTGACACCCAATTCTTTCGATAACAATTACTTCAAGAATCTCATT
CAGAAGAAGGGACTTCTTGCATCAGACCAAGTTCTGTTTAGTGGTGGATCGACTGACTCCATTGTTGATGAATATAGCAAAAACCCTTCAAAATTTAAATCTGATTTTGCTGCTGCCATG
ATCAAGATGGCAGATATCAGTCCTCTCACTGGCTCTGCTGGAGAAATTCGACGAGTTTGCAATCTTGTCAACTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTTCTCTTTATCAAACAAATAAGTTCACGTGTACAATTATTGTCTCCATGTTTTTGTTGATCATCTCTACGCAATCTGAAGCACAACTCTCACCAACATTTTACGATGCCACTTGC
CCAAGTGCCCTCAACACAATCCGAACAGGCATTAGAAATGCTGTTTCACGAGAGCGTAGGATGTCGGCATCCCTCATTCGCCTCCATTTTCATGATTGCTTCGTTCAAGGTTGTGACGCG
TCCATTTTGTTGGACGATTCCTCCTCCATTGACAGCGAGAAAAATGCACTTCCAAATTTTAAATCAGCTAGAGGGTTCGAAGTTATAGATAGTGTCAAGTCTCAACTGGAGAGAGTTTGC
CCTGGAGTTGTTTCATGCGCTGATATCGTTGCTGTTGCAGCCCGTGATGCTTCTTTTGCT
GTTGGTGGACCATCATGGAGAGTTAAGCTTGGTCGAAGAGACTCAACAACTGCAAGCAGA
AGCTTAGCAGAAAACCTCCCCAGCTTTACAGATGGATTGGACAAACTTATTTCCACCTTCGCTACCAAAGGCTTGAATGCAAGAGACTTGGTTGCCCTTTCAG
GAGCTCATACAATTGGC
CAAGCACAGTGTGCATTTTTCCGTGATAGGATTTATAGCAATCAAAGCAATATTGATGCTGGATTCGCGAGCACTCGTAGACGTCAGTGTCCGGCTAATGGTGGTGACAGCAATCTATCA
CCACTTGATTTAGTGACACCCAATTCTTTCGATAACAATTACTTCAAGAATCTCATTCAGAAGAAGGGACTTCTTGCATCAGACCAAGTTCTGTTTAGTGGTGGATCGACTGACTCCATT
GTTGATGAATATAGCAAAAACCCTTCAAAATTTAAATCTGATTTTGCTGCTGCCATGATCAAGATGGCAGATATCAGTCCTCTCACTGGCTCTGCTGGAGAAATTCGACGAGTTTGCAAT
CTTGTCAACTAA

Retrieve as FASTA