Entry information : CclPrx108 (clementine0.9_033323m)
Entry ID 8669
Creation 2011-06-25 (Qiang Li)
Last sequence changes 2011-12-13 (Qiang Li)
Sequence status partial
Reviewer Not yet reviewed
Last annotation changes 2012-01-04 (Qiang LI)
Peroxidase information: CclPrx108 (clementine0.9_033323m)
Name (synonym) CclPrx108 (clementine0.9_033323m)
Class Class III peroxidase     [Orthogroup: Prx014]*
Taxonomy Eukaryota Viridiplantae Streptophyta Rutaceae Citrus
Organism Citrus clementina    [TaxId: 85681 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value CclPrx108
start..stop
S start..stop
CclPrx85 290 7e-100 27..182 161..317
CclPrx85 62 0.000000000003 1..30 1..30
CsPrx23 285 3e-98 27..182 167..323
CsPrx23 50 0.00000005 1..30 1..36
CclPrx117 285 4e-98 27..182 167..323
CclPrx117 50 0.00000007 1..30 1..36
CclPrx103 284 1e-97 27..182 167..323
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 1094144..1094303 160 N° 2 1094449..1094837 389  
join(1094144..1094303,1094449..1094837)


exon

Literature and cross-references CclPrx108 (clementine0.9_033323m)
DNA ref. Phytozome 12:   scaffold_15 (1094144..1094837)
Protein sequence: CclPrx108 (clementine0.9_033323m)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   182 (159)
PWM (Da):   %s   19641.97 (17167.6)  
PI (pH):   %s   8.48 (8.95) Peptide Signal:   %s   cut: 24 range:24-182
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MASLSQIIFVSILLLIISTQCEAQLSPTFYGLDTLISTFATKGFSARDLVALSGAHTIGRAQCAFFRDRIYNNQSDIDAGFASTRRRQCPASGGDSNLSPLDLVTPRSFDNNYFKNLVQKKGLLASDQVLFSGRSTDSIVAEYSKNCSKFKSDFAAAMIEMADISPLTGTAGQIRRVCNLVN

Retrieve as FASTA  
Remarks Partial sequence from genomic. Incorrect prediction from phytozome (A big 5' end is missing).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTTCCCTTTCTCAAATAATATTTGTCTCCATATTGTTGTTGATCATCTCTACACAATGTGAAGCACAACTCTCACCAACATTCTATGGATTGGACACACTTATTTCCACCTTCGCT
ACCAAGGGCTTTAGCGCAAGAGACTTGGTTGCCCTTTCAG
GTACCTCTCTCTCTGTATATATATCTTCATCTCATTATGTGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGCTTCGTTTGAAATTCAGGAGCTCATACAATCGGCCGAGCGCAATGTGCGTTTTTCCGTGATAGGATTTATAA
CAATCAAAGCGATATTGACGCCGGATTTGCAAGCACTCGAAGGCGTCAGTGTCCTGCTAGTGGTGGTGACAGCAACCTATCACCACTTGATTTGGTGACACCCCGTTCTTTTGATAACAA
TTACTTTAAGAATCTCGTTCAGAAGAAAGGACTTCTTGCATCAGACCAAGTTCTCTTTAGTGGCAGATCCACTGACTCAATTGTTGCTGAATATAGCAAAAATTGTTCAAAATTTAAGTC
TGATTTTGCAGCTGCTATGATCGAGATGGCAGATATCAGTCCTCTAACTGGCACTGCCGGACAAATTCGAAGAGTTTGCAATCTTGTCAACTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTTCCCTTTCTCAAATAATATTTGTCTCCATATTGTTGTTGATCATCTCTACACAATGTGAAGCACAACTCTCACCAACATTCTATGGATTGGACACACTTATTTCCACCTTCGCT
ACCAAGGGCTTTAGCGCAAGAGACTTGGTTGCCCTTTCAG
GAGCTCATACAATCGGCCGAGCGCAATGTGCGTTTTTCCGTGATAGGATTTATAACAATCAAAGCGATATTGACGCCGGA
TTTGCAAGCACTCGAAGGCGTCAGTGTCCTGCTAGTGGTGGTGACAGCAACCTATCACCACTTGATTTGGTGACACCCCGTTCTTTTGATAACAATTACTTTAAGAATCTCGTTCAGAAG
AAAGGACTTCTTGCATCAGACCAAGTTCTCTTTAGTGGCAGATCCACTGACTCAATTGTTGCTGAATATAGCAAAAATTGTTCAAAATTTAAGTCTGATTTTGCAGCTGCTATGATCGAG
ATGGCAGATATCAGTCCTCTAACTGGCACTGCCGGACAAATTCGAAGAGTTTGCAATCTTGTCAACTGA

Retrieve as FASTA