Entry information : CclPrx115 ( clementine0.9_034835m)
Entry ID 8676
Creation 2011-06-25 (Qiang Li)
Last sequence changes 2011-10-03 (Qiang Li)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2016-01-28 (Christophe Dunand)
Peroxidase information: CclPrx115 ( clementine0.9_034835m)
Name (synonym) CclPrx115 ( clementine0.9_034835m)
Class Class III peroxidase    [Orthogroup: Prx034]
Taxonomy Eukaryota Viridiplantae Streptophyta Rutaceae Citrus
Organism Citrus clementina    [TaxId: 85681 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value CclPrx115
start..stop
S start..stop
CsPrx48 659 0 1..320 1..320
MePrx90 532 0 9..320 12..323
PpePrx62 530 0 6..320 10..324
RcPrx67 526 0 4..320 7..323
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 3873485..3873694 210 N° 2 3873172..3873360 189 N° 3 3872324..3872887 564  
complement(join(3872324..3872887,3873172..3873360,3873485..3873694))


exon

Literature and cross-references CclPrx115 ( clementine0.9_034835m)
DNA ref. Phytozome 12:   scaffold_6 (3873694..3872324)
Protein sequence: CclPrx115 ( clementine0.9_034835m)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   320 (297)
PWM (Da):   %s   34987.79 (32624.4)  
PI (pH):   %s   7.69 (7.74) Peptide Signal:   %s   cut: 24 range:24-320
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MVAKNLVCAIILLLLVSLGQAEAALNAHYYDQTCPQAEKIILDAVRNASMHDPKVPARILRMFFHDCFIRGCDASVLLDSTPQNKAEKDGPPNISVRSFYVIDDAKAELEKACPHTVSCADIIAIAARDVVTMSGGPYWNVLKGRKDGRVSKASETRSLPAPTFNVTQLIQSFAQRGLGVQDLVALSGGHTLGFSHCSSFEARLRNFSSLLDIDPSMDLDFAEKLRSKCPKPNKDRNAGQFLDSTSSAFDNNYYKQLTVGKGVFGSDQSLFGDFRTKWIVESFAIDQGLFFKEFVNSMVKLGNVSIIENGEVRLKCGVVN*

Retrieve as FASTA  
Remarks Complete sequence from genomic (introns 1 and 2). Incorrect prediction from phytozome (Short 5' end is missing which has been completed).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGTTGCAAAGAATCTCGTCTGTGCAATTATTCTGCTTCTCTTAGTGTCACTTGGGCAGGCAGAGGCAGCACTGAATGCACATTATTATGATCAAACGTGCCCGCAAGCCGAGAAAATC
ATTTTAGATGCTGTTCGTAATGCTTCAATGCATGACCCGAAAGTCCCAGCTCGCATCCTCAGGATGTTCTTTCACGATTGTTTCATAAGG
GTATGATTGTTAATTAATTCTTCTCCTCTT
TAAGTACTCCGAAAAATTAACGAGCCAAAAAATTAATTGAATGGCCTCTAATTTGCTATGGTTTCAAATGATGATATTATGGTATGAAACATAGGGATGTGATGCGTCGGTGTTGCTGGA
CTCGACTCCGCAAAACAAAGCTGAAAAGGATGGCCCTCCGAATATCTCAGTTCGATCATTTTATGTGATTGATGACGCAAAAGCTGAGCTTGAAAAGGCTTGCCCACACACAGTTTCTTG
CGCCGATATAATCGCCATTGCAGCAAGGGATGTAGTAACCATG
GTGATGCTCAATTTCTTAGCGTGCTGTATAATATATACATCACGTGCAAATTGCACTCAATATGCCCCAATAACATA
GAAATTGCATAAGCTAGAATTCTGAGTGTTTTCTCATACACCTGACCTTACAAATTATGTAATCTTATTACTCAATCCACTTACCCGACCTTACTCGACACCGAGTTTCNNNNNNNNNNN
NNNNNNNNNNNCGCCCTGTCTTTCTTGAATTATTATATATGATATATTATCTTGATTTATATCTTTTTATTTGTTTATTTTTGATAGTCTGGAGGACCTTATTGGAATGTTCTAAAAGGA
AGGAAAGATGGAAGAGTGTCCAAAGCATCCGAAACAAGAAGCTTACCAGCACCAACGTTCAACGTGACACAACTCATTCAAAGTTTTGCACAAAGAGGCTTAGGAGTTCAAGATTTGGTT
GCTTTATCAGGTGGCCACACTCTAGGGTTTTCACACTGCTCATCATTTGAAGCCAGGCTACGTAACTTCAGTTCACTGCTTGACATTGACCCATCTATGGATCTTGACTTCGCCGAAAAG
CTTAGAAGCAAATGCCCAAAACCAAACAAAGATCGCAATGCTGGACAGTTCTTGGACTCTACATCGTCCGCTTTTGATAACAACTATTACAAACAACTTACGGTAGGTAAGGGCGTGTTT
GGATCAGATCAATCTCTGTTTGGCGATTTCAGGACCAAGTGGATTGTTGAATCGTTTGCCATAGACCAGGGTTTGTTCTTCAAAGAGTTCGTGAATTCTATGGTGAAGCTTGGAAATGTG
AGTATTATTGAAAATGGAGAAGTGAGACTCAAATGCGGAGTGGTTAATTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGTTGCAAAGAATCTCGTCTGTGCAATTATTCTGCTTCTCTTAGTGTCACTTGGGCAGGCAGAGGCAGCACTGAATGCACATTATTATGATCAAACGTGCCCGCAAGCCGAGAAAATC
ATTTTAGATGCTGTTCGTAATGCTTCAATGCATGACCCGAAAGTCCCAGCTCGCATCCTCAGGATGTTCTTTCACGATTGTTTCATAAGG
GGATGTGATGCGTCGGTGTTGCTGGACTCG
ACTCCGCAAAACAAAGCTGAAAAGGATGGCCCTCCGAATATCTCAGTTCGATCATTTTATGTGATTGATGACGCAAAAGCTGAGCTTGAAAAGGCTTGCCCACACACAGTTTCTTGCGCC
GATATAATCGCCATTGCAGCAAGGGATGTAGTAACCATG
TCTGGAGGACCTTATTGGAATGTTCTAAAAGGAAGGAAAGATGGAAGAGTGTCCAAAGCATCCGAAACAAGAAGCTTACCA
GCACCAACGTTCAACGTGACACAACTCATTCAAAGTTTTGCACAAAGAGGCTTAGGAGTTCAAGATTTGGTTGCTTTATCAGGTGGCCACACTCTAGGGTTTTCACACTGCTCATCATTT
GAAGCCAGGCTACGTAACTTCAGTTCACTGCTTGACATTGACCCATCTATGGATCTTGACTTCGCCGAAAAGCTTAGAAGCAAATGCCCAAAACCAAACAAAGATCGCAATGCTGGACAG
TTCTTGGACTCTACATCGTCCGCTTTTGATAACAACTATTACAAACAACTTACGGTAGGTAAGGGCGTGTTTGGATCAGATCAATCTCTGTTTGGCGATTTCAGGACCAAGTGGATTGTT
GAATCGTTTGCCATAGACCAGGGTTTGTTCTTCAAAGAGTTCGTGAATTCTATGGTGAAGCTTGGAAATGTGAGTATTATTGAAAATGGAGAAGTGAGACTCAAATGCGGAGTGGTTAAT
TAA

Retrieve as FASTA