Entry information : CclPrx117 (clementine0.9_034921m)
Entry ID 8678
Creation 2011-06-25 (Qiang Li)
Last sequence changes 2012-01-04 (Qiang Li)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2011-12-05 (Qiang Li)
Peroxidase information: CclPrx117 (clementine0.9_034921m)
Name (synonym) CclPrx117 (clementine0.9_034921m)
Class Class III peroxidase    [Orthogroup: Prx012]
Taxonomy Eukaryota Viridiplantae Streptophyta Rutaceae Citrus
Organism Citrus clementina    [TaxId: 85681 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value CclPrx117
start..stop
S start..stop
CsPrx23 627 0 1..323 1..323
CclPrx103 598 0 1..323 1..323
CclPrx97 595 0 1..323 1..323
CclPrx85 562 0 1..323 1..317
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 1030840..1031259 420 N° 2 1030519..1030681 163 N° 3 1029994..1030382 389  
complement(join(1029994..1030382,1030519..1030681,1030840..1031259))


exon

Literature and cross-references CclPrx117 (clementine0.9_034921m)
DNA ref. Phytozome 11:   scaffold_15 (1031259..1029994)
Protein sequence: CclPrx117 (clementine0.9_034921m)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   323 (294)
PWM (Da):   %s   34874.67 (31696.1)  
PI (pH):   %s   8.41 (8.57) Peptide Signal:   %s   cut: 30 range:30-323
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MASFSQTNKFTCTIFVSTLLLIISTQCEAQLSPTFYDATCPSALNTIRTGIRNAASRERRMAASLIRLHFHDCFVQGCDASILLDDSSSIDSEKNALPNFKSARGFEVIDSVKSQLERVCPGVVSCVISLLLQPVMLLSLVGGPSWTVKLGRKDSTTASRSLAENLPSFTDGLDKLISTFATKGLNARDLVALSGAHTIGQAQCAFFRDRIYNNQSNIDAGFASTRRRQCPANGGDSNLSPLDLVTPNSFDNNYFKNLIQKKGLLASDQVLFSGGSTDYIVDEYSKNPSKFKSDFAAAMIKMADISPLTGTAGQIRRVCNIVN

Retrieve as FASTA  
Remarks Complete sequence from genomic. Incorrect prediction from phytozome (A sequence 'VISLLLQPVMLLSL' is missing in exon 2 which has been completed).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTTCCTTTTCTCAAACAAATAAGTTTACGTGTACAATTTTTGTCTCCACGTTGTTGTTGATCATCTCTACGCAATGTGAAGCACAACTTTCACCAACATTCTACGATGCCACTTGC
CCAAGTGCCCTCAACACAATCCGAACAGGCATTAGAAATGCTGCTTCACGAGAGCGTAGGATGGCGGCATCCCTCATTCGCCTCCATTTTCATGATTGCTTCGTTCAAGGTTGTGACGCG
TCCATTTTGTTGGACGATTCCTCCTCCATTGACAGCGAGAAAAATGCACTTCCAAATTTTAAATCAGCTAGAGGGTTCGAAGTTATAGATAGTGTCAAGTCTCAACTGGAGAGAGTTTGC
CCTGGAGTTGTTTCATGCGTGATATCGTTGCTGTTGCAGCCCGTGATGCTTCTTTCGCTG
TGAGTAAATCATCATTAATTTTCTACAAGATTAATACAATAAGAGACATAGTGCTAACAG
AAACAGTGATAAGCCGATGCCGTTCTGTGCTATTAATTTTGATATATAATTCATTGTTAGTTCTGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCAGGTTGGAGGACCATCATGGACAG
TTAAGCTTGGTAGAAAAGACTCAACAACTGCAAGCAGAAGCCTGGCTGAAAATCTCCCTAGCTTTACAGATGGCCTGGACAAACTTATTTCCACCTTCGCTACCAAAGGCTTGAATGCAA
GAGACTTGGTTGCCCTTTCAG
GTATCCCTCCCTCTCTCTCTATATATATATATAATATTTGCCAGATCATAATGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNGTTTCATTTGAAATTCAGGAGCTCATACAATTGGCCAAGCACAATGTGCATTTTTCCGTGACAGGATTTATAACAATCAAAGCAATATTGATGCTGGATTC
GCGAGCACTCGAAGGCGTCAGTGCCCGGCTAATGGTGGCGACAGCAATCTATCACCACTTGATTTGGTGACACCCAATTCTTTCGATAACAATTACTTCAAGAATCTCATTCAGAAGAAG
GGACTTCTCGCATCAGACCAAGTTCTTTTTAGTGGTGGATCCACCGACTACATCGTTGATGAATATAGCAAAAACCCTTCAAAATTTAAATCTGATTTTGCAGCTGCCATGATTAAGATG
GCAGATATCAGTCCTCTCACAGGCACTGCTGGACAAATTCGAAGAGTTTGCAATATTGTCAACTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTTCCTTTTCTCAAACAAATAAGTTTACGTGTACAATTTTTGTCTCCACGTTGTTGTTGATCATCTCTACGCAATGTGAAGCACAACTTTCACCAACATTCTACGATGCCACTTGC
CCAAGTGCCCTCAACACAATCCGAACAGGCATTAGAAATGCTGCTTCACGAGAGCGTAGGATGGCGGCATCCCTCATTCGCCTCCATTTTCATGATTGCTTCGTTCAAGGTTGTGACGCG
TCCATTTTGTTGGACGATTCCTCCTCCATTGACAGCGAGAAAAATGCACTTCCAAATTTTAAATCAGCTAGAGGGTTCGAAGTTATAGATAGTGTCAAGTCTCAACTGGAGAGAGTTTGC
CCTGGAGTTGTTTCATGCGTGATATCGTTGCTGTTGCAGCCCGTGATGCTTCTTTCGCTG
GTTGGAGGACCATCATGGACAGTTAAGCTTGGTAGAAAAGACTCAACAACTGCAAGCAGA
AGCCTGGCTGAAAATCTCCCTAGCTTTACAGATGGCCTGGACAAACTTATTTCCACCTTCGCTACCAAAGGCTTGAATGCAAGAGACTTGGTTGCCCTTTCAG
GAGCTCATACAATTGGC
CAAGCACAATGTGCATTTTTCCGTGACAGGATTTATAACAATCAAAGCAATATTGATGCTGGATTCGCGAGCACTCGAAGGCGTCAGTGCCCGGCTAATGGTGGCGACAGCAATCTATCA
CCACTTGATTTGGTGACACCCAATTCTTTCGATAACAATTACTTCAAGAATCTCATTCAGAAGAAGGGACTTCTCGCATCAGACCAAGTTCTTTTTAGTGGTGGATCCACCGACTACATC
GTTGATGAATATAGCAAAAACCCTTCAAAATTTAAATCTGATTTTGCAGCTGCCATGATTAAGATGGCAGATATCAGTCCTCTCACAGGCACTGCTGGACAAATTCGAAGAGTTTGCAAT
ATTGTCAACTAA

Retrieve as FASTA