Entry information : CclPrx47 (clementine0.9_016012m)
Entry ID 8703
Creation 2011-06-25 (Qiang Li)
Last sequence changes 2011-10-03 (Qiang Li)
Sequence status complete
Reviewer Qiang Li
Last annotation changes 2012-01-04 (Qiang LI)
Peroxidase information: CclPrx47 (clementine0.9_016012m)
Name (synonym) CclPrx47 (clementine0.9_016012m)
Class Class III peroxidase    [Orthogroup: Prx008]
Taxonomy Eukaryota Viridiplantae Streptophyta Rutaceae Citrus
Organism Citrus clementina    [TaxId: 85681 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value CclPrx47
start..stop
S start..stop
MePrx27 544 0 1..320 3..326
GmPrx328 533 0 1..320 1..320
GmPrx158 531 0 1..320 1..320
PtPrx68 523 0 2..320 4..322
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 2668087..2668299 213 N° 2 2667618..2667809 192 N° 3 2667331..2667496 166 N° 4 2666824..2667215 392
complement(join(2666824..2667215,2667331..2667496,2667618..2667809,2668087..2668 299))


exon

Literature and cross-references CclPrx47 (clementine0.9_016012m)
DNA ref. Phytozome 12:   scaffold_20 (2668299..2666824)
Protein sequence: CclPrx47 (clementine0.9_016012m)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   320 (296)
PWM (Da):   %s   34230.21 (31668.9)  
PI (pH):   %s   9.61 (9.41) Peptide Signal:   %s   cut: 25 range:25-320
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MASFFKFFLTLALLVLAMGSSTNAQLSTNFYANTCKNLLPTVKSVVQSAISKEARMGASLLRLFFHDCFVNGCDGSVLLDNTSSFTGEKNANANRNSARGFEVIDNIKSAVEKACPGVVSCADILAITARDSVVILGGPSWQVKLGRRDARTASLSAANSGIPAPTSNLNQLISRFNALGLSNKDLVALAGGHTIGQARCTSFRAHIYNETNIDASFARTRQGNCPRANGTGDNNLAPLDLQTPTCFDNNYFRNLVNRKGLLHSDQQLFNGGSTDSQVRTYSNNPSTFSSDFVAGMIKMGDISPLTGSRGEIRKNCRRVN

Retrieve as FASTA  
Remarks Complete sequence from genomic.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTTCGTTTTTCAAGTTCTTTCTGACTTTGGCACTCCTTGTGCTTGCCATGGGGAGCAGCACAAACGCTCAACTCTCTACAAATTTCTACGCAAACACTTGCAAAAACCTCCTCCCC
ACTGTGAAATCTGTCGTGCAATCTGCTATTTCAAAAGAGGCTCGCATGGGCGCCTCTCTCCTTCGCTTGTTCTTCCACGATTGCTTCGTTAAC
GTAATCCATTATTAATTGATCCATATA
TTGTACATGTTTCAATTTTTGTTTTTTTTTTTAGTAGTTATAACCTACAAATATATATATTAAAGCTCCCGATCCACGGTGGCTCGAACGGGTGCCCTCAAGCCTCAACATTTATTAATT
TTGAATATAGAGTTTGATNNNNNNNNNNNNNNNNNNNNNNNNNNNCGGCTGGCAAACAATAACAAGTGTTGACCAAATTAGACATTTCCATGGTAACATTATATTGTTGTGTTCTGCCTG
CGTATGACAGGGATGCGATGGATCAGTTCTACTGGACAACACATCATCTTTCACTGGAGAGAAAAATGCGAATGCCAATCGTAACTCCGCCCGCGGATTCGAGGTCATCGACAACATTAA
GTCCGCAGTTGAGAAAGCTTGCCCCGGTGTGGTCTCTTGTGCTGATATATTAGCCATTACTGCTCGAGACTCAGTTGTTATA
GTAAGCTCTGAGTTAATTAATTAATTAATCTTAATTAA
ACCATATGATACATCATCAAATTGAGCATCAATTCTGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCGAAGCTTGGAGGCCCAAGCTGGCAAGTAAAACTCGGAAGGA
GAGATGCTAGAACTGCAAGCCTATCTGCTGCTAATAGCGGCATTCCAGCTCCTACCTCAAACTTGAATCAACTCATCTCTAGGTTCAACGCTCTCGGACTTTCCAACAAGGACCTTGTTG
CTTTAGCAG
GTTTGTTCCTGTCTCCAGGAAATTTCCTGAGAGAATTCTGGTCTCGATATTAAAAAAGAGTCACACTTCTTACAAAAGNNNNNNNNNNNNNNNNNNNNNNNGTAAAACATT
TCAGGTGGACATACAATCGGACAGGCGAGGTGCACATCATTCAGGGCTCACATATACAACGAGACAAACATTGATGCTTCATTTGCTCGAACAAGGCAAGGGAACTGCCCAAGGGCCAAT
GGCACAGGCGACAACAACTTGGCACCGCTTGATCTGCAAACTCCTACTTGTTTTGACAACAATTACTTCAGGAACCTGGTCAACAGAAAGGGATTGCTTCACTCTGATCAACAGCTGTTC
AATGGTGGGTCCACTGATTCACAAGTCCGCACGTACAGTAACAACCCGAGCACCTTCAGCTCTGATTTTGTCGCCGGCATGATCAAGATGGGAGATATCAGCCCACTCACTGGATCCCGC
GGTGAAATTAGGAAGAATTGCAGGAGGGTCAATTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTTCGTTTTTCAAGTTCTTTCTGACTTTGGCACTCCTTGTGCTTGCCATGGGGAGCAGCACAAACGCTCAACTCTCTACAAATTTCTACGCAAACACTTGCAAAAACCTCCTCCCC
ACTGTGAAATCTGTCGTGCAATCTGCTATTTCAAAAGAGGCTCGCATGGGCGCCTCTCTCCTTCGCTTGTTCTTCCACGATTGCTTCGTTAAC
GGATGCGATGGATCAGTTCTACTGGAC
AACACATCATCTTTCACTGGAGAGAAAAATGCGAATGCCAATCGTAACTCCGCCCGCGGATTCGAGGTCATCGACAACATTAAGTCCGCAGTTGAGAAAGCTTGCCCCGGTGTGGTCTCT
TGTGCTGATATATTAGCCATTACTGCTCGAGACTCAGTTGTTATA
CTTGGAGGCCCAAGCTGGCAAGTAAAACTCGGAAGGAGAGATGCTAGAACTGCAAGCCTATCTGCTGCTAATAGC
GGCATTCCAGCTCCTACCTCAAACTTGAATCAACTCATCTCTAGGTTCAACGCTCTCGGACTTTCCAACAAGGACCTTGTTGCTTTAGCAG
GTGGACATACAATCGGACAGGCGAGGTGC
ACATCATTCAGGGCTCACATATACAACGAGACAAACATTGATGCTTCATTTGCTCGAACAAGGCAAGGGAACTGCCCAAGGGCCAATGGCACAGGCGACAACAACTTGGCACCGCTTGAT
CTGCAAACTCCTACTTGTTTTGACAACAATTACTTCAGGAACCTGGTCAACAGAAAGGGATTGCTTCACTCTGATCAACAGCTGTTCAATGGTGGGTCCACTGATTCACAAGTCCGCACG
TACAGTAACAACCCGAGCACCTTCAGCTCTGATTTTGTCGCCGGCATGATCAAGATGGGAGATATCAGCCCACTCACTGGATCCCGCGGTGAAATTAGGAAGAATTGCAGGAGGGTCAAT
TAA

Retrieve as FASTA