Entry information : CclPrx49 (clementine0.9_016048m)
Entry ID 8705
Creation 2011-06-25 (Qiang Li)
Last sequence changes 2011-10-03 (Qiang Li)
Sequence status complete
Reviewer Qiang Li
Last annotation changes 2012-01-04 (Qiang LI)
Peroxidase information: CclPrx49 (clementine0.9_016048m)
Name (synonym) CclPrx49 (clementine0.9_016048m)
Class Class III peroxidase    [Orthogroup: Prx025]
Taxonomy Eukaryota Viridiplantae Streptophyta Rutaceae Citrus
Organism Citrus clementina    [TaxId: 85681 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value CclPrx49
start..stop
S start..stop
CsPrx18 648 0 1..319 1..319
PatrPrx01 518 0 8..319 6..316
PtPrx53 514 0 8..319 6..316
EcamPrx191 505 0 1..319 1..317
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 166140..166358 219 N° 2 166641..166832 192 N° 3 166976..167524 549  
join(166140..166358,166641..166832,166976..167524)


exon

Literature and cross-references CclPrx49 (clementine0.9_016048m)
DNA ref. Phytozome 12:   scaffold_111 (166140..167524)
Protein sequence: CclPrx49 (clementine0.9_016048m)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   319 (293)
PWM (Da):   %s   33929.93 (31216.5) Transmb domain:   %s   i5-27o
PI (pH):   %s   8.65 (8.76) Peptide Signal:   %s   cut: 27 range:27-319
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MASSISYLFVTLILTIISLLACTSTAQLSPTFYATSCPNFQRIARDEMTKAVNRQPRNAASILRLFFHDCFVNGCDGSVLLDDTATFTGEKNAGPNRNSARGFEVIDAIKTRLEAACNATVSCADILAVAARDGVALLGGPTWTVPLGRRDARTASQSAANSQIPGPSSSLATLISMFAAKGLTAQDMTVLSGGHAIGFARCAAFRNRIYNDTNIDPAFATTRRTTCPATGGDPNLAPLDQTPNRFDNSYYQNLVNRRGLLHSDQELFNGGSQDATVRGYSTNPASFARDFAAAMVKMGNISPLTGTNGEIRRNCRVVN*

Retrieve as FASTA  
Remarks Complete sequence from genomic.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCATCTTCAATTTCTTATTTGTTTGTTACACTTATACTCACAATTATATCCCTTCTAGCTTGCACCTCCACTGCGCAACTTTCTCCAACCTTTTATGCAACATCTTGCCCCAATTTT
CAAAGAATCGCGAGGGATGAAATGACCAAAGCTGTTAATAGACAACCGCGTAATGCTGCCTCTATTCTTCGCCTCTTCTTCCATGACTGCTTCGTTAAT
GTACGTTTTTGCTAGTGTGTG
TGTGTGTATGTACAGTGGTGATCTAATCTAAGATTCTAAACNNNNNNNNNNNNNNNNNNNNNNGACATACTTTTATTTTTCATGTTCTAGAAGTATAAATATGTTCACATTAGAGTCAAC
TTGTCCTGAATTTTAATCTCCGGATTAGNNNNNNNNNNNNNNNNNNNNNNNGTTTCTAATTTTATCATGATTTGGGAGTTACNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNGGTTTTTTTAGGGCTGCGATGGGTCGGTACTACTAGATGACACAGCCACATTCACCGGCGAGAAGAATGCAGGACCAAACAGAAACTCTGCTAGGGGTTTCGAAGTGATT
GACGCCATTAAAACTCGTCTGGAAGCAGCTTGCAACGCCACCGTTTCATGTGCCGACATCCTTGCTGTTGCAGCCCGAGACGGTGTCGCCTTG
GTCAGTCATTGCTTGCTTTTTGTTGAA
ATATTAATAGCACAGTTTAATTTTGCATGCAAGTATATGTGTGCTTTTGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGCAGCTTG
GAGGACCGACTTGGACGGTACCGCTCGGCCGGCGAGATGCAAGAACGGCCAGTCAGAGTGCAGCCAATAGCCAAATCCCTGGACCATCCTCCAGCCTGGCAACACTCATATCAATGTTTG
CAGCCAAAGGCCTGACCGCCCAAGACATGACAGTCCTCTCCGGCGGCCACGCCATCGGATTCGCTCGATGCGCCGCCTTCCGGAACCGCATATACAACGACACCAACATTGACCCAGCTT
TTGCAACCACCAGAAGAACAACCTGCCCGGCTACTGGCGGCGACCCCAATCTTGCTCCCCTGGACCAGACTCCGAACCGGTTCGATAACAGCTACTATCAGAACCTGGTGAACCGACGCG
GGCTGCTTCATTCTGATCAGGAGCTGTTCAATGGTGGCTCTCAGGATGCAACTGTTAGGGGTTATAGTACGAATCCTGCCTCTTTTGCTAGAGACTTTGCTGCTGCAATGGTCAAAATGG
GCAATATTAGCCCACTCACTGGGACTAATGGAGAGATTAGGAGAAACTGCAGGGTGGTTAATTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCATCTTCAATTTCTTATTTGTTTGTTACACTTATACTCACAATTATATCCCTTCTAGCTTGCACCTCCACTGCGCAACTTTCTCCAACCTTTTATGCAACATCTTGCCCCAATTTT
CAAAGAATCGCGAGGGATGAAATGACCAAAGCTGTTAATAGACAACCGCGTAATGCTGCCTCTATTCTTCGCCTCTTCTTCCATGACTGCTTCGTTAAT
GGCTGCGATGGGTCGGTACTA
CTAGATGACACAGCCACATTCACCGGCGAGAAGAATGCAGGACCAAACAGAAACTCTGCTAGGGGTTTCGAAGTGATTGACGCCATTAAAACTCGTCTGGAAGCAGCTTGCAACGCCACC
GTTTCATGTGCCGACATCCTTGCTGTTGCAGCCCGAGACGGTGTCGCCTTG
CTTGGAGGACCGACTTGGACGGTACCGCTCGGCCGGCGAGATGCAAGAACGGCCAGTCAGAGTGCAGCC
AATAGCCAAATCCCTGGACCATCCTCCAGCCTGGCAACACTCATATCAATGTTTGCAGCCAAAGGCCTGACCGCCCAAGACATGACAGTCCTCTCCGGCGGCCACGCCATCGGATTCGCT
CGATGCGCCGCCTTCCGGAACCGCATATACAACGACACCAACATTGACCCAGCTTTTGCAACCACCAGAAGAACAACCTGCCCGGCTACTGGCGGCGACCCCAATCTTGCTCCCCTGGAC
CAGACTCCGAACCGGTTCGATAACAGCTACTATCAGAACCTGGTGAACCGACGCGGGCTGCTTCATTCTGATCAGGAGCTGTTCAATGGTGGCTCTCAGGATGCAACTGTTAGGGGTTAT
AGTACGAATCCTGCCTCTTTTGCTAGAGACTTTGCTGCTGCAATGGTCAAAATGGGCAATATTAGCCCACTCACTGGGACTAATGGAGAGATTAGGAGAAACTGCAGGGTGGTTAATTAA

Retrieve as FASTA