Entry information : Mpu2CysPrx01
Entry ID 8706
Creation 2011-06-25 (Qiang Li)
Last sequence changes 2016-02-03 (Christophe Dunand)
Sequence status complete
Reviewer Bruno Savelli
Last annotation changes 2017-03-27 (Bruno Savelli)
Peroxidase information: Mpu2CysPrx01
Name Mpu2CysPrx01
Class Typical 2-Cysteine peroxiredoxin    [Orthogroup: 2CysPrx001]
Taxonomy Eukaryota Viridiplantae Chlorophyta Prasinophyceae Micromonas
Organism Micromonas pusilla    [TaxId: 38833 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value Mpu2CysPrx01
start..stop
S start..stop
Cre2CysPrx01 366 4e-130 13..250 1..235
Cin2CysPrx01 365 9e-130 13..250 1..235
Cv2CysPrx01 357 9e-127 17..250 2..239
Mvi2CysPrx 355 3e-126 42..250 1..210
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 36134..36669 536 N° 2 35733..35949 217  
complement(join(35733..35949,36134..36669))


exon

Literature and cross-references Mpu2CysPrx01
DNA ref. GenBank:   HC753926.1
Protein sequence: Mpu2CysPrx01
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   250
PWM (Da):   %s   26913.42  
PI (pH):   %s   4.96
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MACIASSTMTARVSARASAASARRATLSSKAPVKARFASSVATKSSARRATTTTASAAPLVGNAAPDFSAEAVFDQEFMNVNLSDYRGKYVVLFFYPLDFTFVCPTEITAFSDRYEEFAKMNTEVLGVSVDSQFSHLAWIQTERNAGGLGDIAYPLVSDLKKEISSAYDVLTEDGVALRGLFIIDKEGVVQHSTINNLAFGRSVDETLRTLQALQHVQENPDEVCPAGWKPGDVTMKPDPEGSKEYFAAI

Retrieve as FASTA  
Remarks Complete sequence from genomic.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCCTGCATCGCTTCCTCCACGATGACCGCGCGCGTCTCCGCGCGCGCGTCCGCCGCGTCCGCGCGCCGCGCGACGCTCTCGTCCAAGGCGCCCGTCAAGGCGCGGTTCGCGTCGTCC
GTCGCGACGAAATCCTCCGCGCGCCGCGCGACGACGACGACCGCGTCCGCGGCGCCGCTCGTCGGCAACGCCGCGCCGGACTTCTCCGCGGAGGCGGTCTTCGACCAGGAGTTCATGAAC
GTCAACCTGAGCGACTACCGCGGCAAGTACGTCGTCCTCTTCTTCTACCCGCTCGACTTCACCTTCGTGTGCCCCACGGAGATCACCGCCTTCTCCGATCGCTACGAAGAGTTCGCGAAG
ATGAACACCGAGGTCCTCGGCGTGTCCGTGGACTCGCAGTTCTCGCACCTCGCGTGGATCCAGACCGAGCGCAACGCCGGCGGCCTCGGCGACATCGCGTACCCGCTCGTCTCCGACCTC
AAGAAGGAGATCTCGTCCGCGTACGACGTCCTCACCGAGGACGGCGTCGCGCTCAG
GCGCGTTCTATACACTGGTCCCCATACGACCGCGTTGGCGTGGTGAACGCCGATCCTTAAGGAC
TTTTCCCGTCGTTTCTCTGCGCCCACACCTCGCTTCTAATCCCCGCCATCGTCGCCTTTCAACTCCTACTGACGCCTTTCAACTCCACCCCGACATCGCTTCGTATGGAACGACCCTCAG

AGGGCTCTTCATCATCGACAAGGAGGGCGTCGTGCAGCACTCCACCATCAACAACCTCGCGTTCGGCCGCTCCGTGGACGAGACGCTGCGCACGCTGCAGGCGCTTCAGCACGTGCAGGA
GAACCCTGATGAGGTTTGCCCGGCGGGGTGGAAGCCCGGCGACGTCACGATGAAGCCGGACCCGGAGGGATCCAAGGAGTACTTCGCCGCCATCTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCCTGCATCGCTTCCTCCACGATGACCGCGCGCGTCTCCGCGCGCGCGTCCGCCGCGTCCGCGCGCCGCGCGACGCTCTCGTCCAAGGCGCCCGTCAAGGCGCGGTTCGCGTCGTCC
GTCGCGACGAAATCCTCCGCGCGCCGCGCGACGACGACGACCGCGTCCGCGGCGCCGCTCGTCGGCAACGCCGCGCCGGACTTCTCCGCGGAGGCGGTCTTCGACCAGGAGTTCATGAAC
GTCAACCTGAGCGACTACCGCGGCAAGTACGTCGTCCTCTTCTTCTACCCGCTCGACTTCACCTTCGTGTGCCCCACGGAGATCACCGCCTTCTCCGATCGCTACGAAGAGTTCGCGAAG
ATGAACACCGAGGTCCTCGGCGTGTCCGTGGACTCGCAGTTCTCGCACCTCGCGTGGATCCAGACCGAGCGCAACGCCGGCGGCCTCGGCGACATCGCGTACCCGCTCGTCTCCGACCTC
AAGAAGGAGATCTCGTCCGCGTACGACGTCCTCACCGAGGACGGCGTCGCGCTCAG
AGGGCTCTTCATCATCGACAAGGAGGGCGTCGTGCAGCACTCCACCATCAACAACCTCGCGTTC
GGCCGCTCCGTGGACGAGACGCTGCGCACGCTGCAGGCGCTTCAGCACGTGCAGGAGAACCCTGATGAGGTTTGCCCGGCGGGGTGGAAGCCCGGCGACGTCACGATGAAGCCGGACCCG
GAGGGATCCAAGGAGTACTTCGCCGCCATCTAA

Retrieve as FASTA