Entry information : SbPrx82 (Sobic.004G359300.1 [2.1] / Sb04g038610 [1.4])
Entry ID 871
Creation 2008-10-20 (Christophe Dunand)
Last sequence changes 2008-10-20 (Christophe Dunand)
Sequence status complete
Reviewer Messaoudi
Last annotation changes 2014-08-04 (Messaoudi)
Peroxidase information: SbPrx82 (Sobic.004G359300.1 [2.1] / Sb04g038610 [1.4])
Name (synonym) SbPrx82 (Sobic.004G359300.1 [2.1] / Sb04g038610 [1.4])
Class Class III peroxidase    [Orthogroup: Prx015]
Taxonomy Eukaryota Viridiplantae Streptophyta Monocotyledons Poaceae Sorghum
Organism Sorghum bicolor    [TaxId: 4558 ]
Cellular localisation N/D
Tissue type Leaves
Inducer Pathogen interaction
Repressor N/D
Best BLASTp hits
Perox score E-value SbPrx82
start..stop
S start..stop
ZmPrx136 542 0 29..330 27..330
SiPrx75 497 5e-179 35..328 29..322
OsPrx32 455 1e-162 5..328 1..322
LuPrx188 417 2e-147 19..327 11..318
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 67964567..67964803 237 N° 2 67964911..67965099 189 N° 3 67967449..67968015 567  
join(67964567..67964803,67964911..67965099,67967449..67968015)


exon

Literature and cross-references SbPrx82 (Sobic.004G359300.1 [2.1] / Sb04g038610 [1.4])
Literature Cordonnier-Pratt,M.-M. et al., unpublished
DNA ref. Phytozome 12:   chromosome_4 (67964567..67968015)
EST ref. GenBank:   BE594811.1 [3' end]
Protein sequence: SbPrx82 (Sobic.004G359300.1 [2.1] / Sb04g038610 [1.4])
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   330 (305)
PWM (Da):   %s   34421.39 (32018.0)  
PI (pH):   %s   7.42 (7.42) Peptide Signal:   %s   cut: 26 range:26-330
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAAALAASSAEAALLLLVLLVRLAAVALRCGEGLSLALYDESCPEAEAAVTAAVRQAMANDRTVAAGLLRMHFHDCFVRGCDGSVLLDSTGTVTAEKDGPPNVSLHAFYVIDNAKRAVEAQCPGVVSCADILALAARDAVALSGGPSWVVALGRRDGRVSRANETTTLPGPTASFEQLKQAFHGRGLSTKDLVVLSGAHTLGFAHCSSFQNRIRLQDQGTDADDPSLSPSFAAALRRACPANNTVRAAGSGLDATSAAFDNTYYRMLQAGQGLLSSDEALLTHPKTRAFVALYAASQEAFFRAFAKSMLRMAALNGGDEVRANCRRVNSS*

Retrieve as FASTA  
Remarks Comlete sequence from genomic (chromo 4, 3 introns) and 2 ESTs. Two-week-old anthracnose-infected leaves.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCGGCGGCGCTTGCTGCATCATCAGCAGAGGCGGCTCTTCTTCTCCTAGTATTATTGGTACGACTCGCCGCGGTGGCGCTGAGATGCGGCGAGGGGCTGAGCCTGGCTTTGTATGAC
GAGAGCTGCCCGGAGGCGGAGGCGGCGGTGACGGCGGCCGTGCGGCAGGCCATGGCAAACGACCGCACCGTGGCGGCTGGGCTCCTCCGAATGCATTTCCACGACTGCTTCGTCAGG
GTA
CGTAATTTTTTCGTTCCATCTATCTCGATCCTTGCATTGCATTTGCTCCTCCTCCGGTCCGCCGCTAGCTGTCTTCTCGATCTGAATCCGGCCGCCGCCGGCAGGGCTGCGACGGCTCCG
TTCTGCTGGACTCGACGGGCACCGTGACGGCAGAGAAGGACGGCCCGCCCAACGTCTCGCTGCACGCTTTCTACGTCATCGACAACGCCAAGCGGGCCGTGGAGGCCCAGTGCCCCGGGG
TCGTCTCGTGCGCCGACATCCTCGCGCTCGCCGCAAGAGACGCCGTCGCGCTG
GTATGTACATGTACGTAATGTACTGTAATGATGTAAAGATGCATGCTGCTGGAGACCGCCGTACTAT
GACTATGGGACTTGGGAGAGATCCAGCTGATCGATGTACTTGCTAGGGTTTAGGATACGGGATGTTTGATACTAATAGCAAAACAAATTACAGAATTTGTCAAAAAACCATGAGACAAAT
TTATTAAGCCTAATTAATTTATCATTAACATGTATGTTACTGTAGTAATTAGTGTCTAATAATAGATTAAGACCTTATTTAGTTTTCAATTTTTTTTGGTTTGGTGCTATAGCAGTTTTA
TTTTTATCTGGTAATTATTATCTAATTATGGACTAATTAGGCTCAAAAGATTCATCTCGCGATTTACAGACAAACTGTATAATTAGTTTTGGTTTTCGACTATATTTAATGCTCCATGCA
TGTACCGCAAAATTCGATGTGACATGAAATCTTGAAAAGTTTTTGATTTTTTGGATGGACTAAACAAGGCCTAATTAGTTTAAAAAGATTCGTCTCACAAAATTTAATTACTCCGTGCAA
TTGGTTTTTTTATTTTACTACATTTAATATTTTATATATATGTTTAAATATTCGATGAGATAGGACGAAATGTTTTTGGGTTGTATGTACTAGTAGCTAGGAGCAGTCGTACATCGGTAA
TATTATTATTGTAGTAATTAGTGTCTAATCATAGATTAACTAGTTTTAAAAGATTTATCTCACAAAATCTAATTACTCTGTGCAATTAGTTTTTTATTTTATCTACATTTAATATGAGAT
ATGACGAAAAGTTTTTGGCAGTACATTGGTAATACCACGTACTTCCTCTATCCCAAAATTTTGGGTTTTCTTGCAAATTTGATTAAAAGTTTATTAGTCAAATTTATCAGTTATTCAATA
GTGTTTTTTTTCACAATAAATCAGTAAATAATATTTTCTGCAATGGCTGACAAGTACAATATTTATTTCTTTAAATAAATTTGTTAAAAAATTAGATTTAAAAATGTTTCTAATGATATT
AGTTACATATAGTAAATATTAATATTTTTAATATATATTTAATCAAAATGGTTTCTATAACGTAGGAGAGGAGTACTGCTGGTGAGCAGTCTTTAATGCTCTAAAGTCTAAACGATTGAG
GCGTTCCCAAAAATTTTGGTACGTGTCGGAAGGACGTCGGGAAAGATTTTTAGAAACTAATAGAAAAACAAATTATATATTTTGTCTGAAAACTGCAAGACAAATCTATTAAGTATAATT
AATCTGTCATTAGCATATATAGGTTACTGTAGCACTTAAAGCTAATCATGGACTAACTAGGCTTAAAAGATTCGTCTCGCGATTTTCAACCAAACTGTGTAATTAGTTTATTTTTTTATT
TACATTTAATATTCTATGCATGTGTTTAAAGATTTGATGGGATAGATGAAAATTTTTTCGTAGGAAACTAAACAGGGCCTAGACTAATTAGGTTTAAAAGATTTATTTCGTAATTTACAG
ATAAATTGTATAATTAGTTTTGTTTATGTCTATATTGAATACTTAGGGTCTGTTTAGTTTCCCTTGCTAAATTTTAGTTGGCTAAAATTATTTTAGCTACTCTTGGATGACTAATGGAAC
TAAACTATTTTAGCTCATTTTAGTCAATGTGTTTGGAACTTTAGTTACTAAAAAATAACTAAATTTTAGCTAGCTAAAAGTTAGCAAGAAGAACCAAACACGATCTTAATACATATGTCG
TAAAATTTGATGTAATAATAAATTTTTAAAAAAATAGTTTTGAGGAACACGACCCGAGTCACATGCTTGCGTCTCTAGCTACTACACTACTGTTGTACTGCTGCTGTTCATCGAGCGAGC
TGTCAACGTGCTGCTCGAGTCTTGCTCGATGTGTCTCGATCCTTGGACCAACAGCACAGGTATGCAGATGCAGCCGCGGCAGCCAGCAGGGTGGGTGTGAGGGTGTCAGTGTCACTCACT
CTGTTCTGTTGTCGTACGTACGTGCACTCATTTTTTTTCGAAGTACTGTACACATGATGCTCGAGCACAACAGATTATTTGCATTATTATTGCGTTAAGGCCTTCGTCATTCGAAAAGGT
TTTGAATTTTGACTGTAGCACTTCATTTTTATTTAATAAATACTATTCAACTTTAACTAACTTTAAAAGATTTATTTCACGATTAACAAGTAAACTATGTAATTAGTTTTTGTTTTTATA
TATATTTAATGTTTTATATATGTACATTAAAATTTAATGTGACGAGAAATATTAAAAAAAATATTTTTGATAAACTAAACAAGTCCTTACTGTTGCTGACCATCGAGCACGTACGCATGC
AGTCCGGTGGTCCGTCGTGGGTGGTGGCCTTGGGGCGGCGGGACGGGCGCGTGTCGCGGGCCAACGAGACGACGACGCTGCCGGGGCCGACGGCTAGCTTTGAGCAGCTGAAGCAGGCGT
TCCACGGCCGCGGGCTGTCCACCAAGGACCTGGTGGTGCTGTCGGGCGCCCACACGCTGGGCTTCGCGCACTGCTCCTCCTTCCAGAACCGCATCCGGCTCCAGGACCAGGGCACCGACG
CCGACGACCCTTCCCTGAGCCCCTCCTTCGCCGCCGCCCTCCGCCGTGCGTGCCCCGCCAACAACACCGTCCGCGCCGCCGGGTCCGGCCTGGACGCCACCTCCGCGGCCTTCGACAACA
CCTACTACCGGATGCTGCAGGCCGGCCAGGGCCTGCTCTCCTCCGACGAGGCGCTGCTCACGCACCCCAAGACGCGCGCCTTCGTCGCGCTCTACGCCGCGTCGCAGGAGGCCTTCTTCA
GGGCCTTCGCCAAGTCCATGCTGCGGATGGCCGCGCTCAACGGAGGCGACGAGGTGCGAGCCAACTGCAGGCGCGTCAACTCATCATGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCGGCGGCGCTTGCTGCATCATCAGCAGAGGCGGCTCTTCTTCTCCTAGTATTATTGGTACGACTCGCCGCGGTGGCGCTGAGATGCGGCGAGGGGCTGAGCCTGGCTTTGTATGAC
GAGAGCTGCCCGGAGGCGGAGGCGGCGGTGACGGCGGCCGTGCGGCAGGCCATGGCAAACGACCGCACCGTGGCGGCTGGGCTCCTCCGAATGCATTTCCACGACTGCTTCGTCAGG
GGC
TGCGACGGCTCCGTTCTGCTGGACTCGACGGGCACCGTGACGGCAGAGAAGGACGGCCCGCCCAACGTCTCGCTGCACGCTTTCTACGTCATCGACAACGCCAAGCGGGCCGTGGAGGCC
CAGTGCCCCGGGGTCGTCTCGTGCGCCGACATCCTCGCGCTCGCCGCAAGAGACGCCGTCGCGCTG
TCCGGTGGTCCGTCGTGGGTGGTGGCCTTGGGGCGGCGGGACGGGCGCGTGTCG
CGGGCCAACGAGACGACGACGCTGCCGGGGCCGACGGCTAGCTTTGAGCAGCTGAAGCAGGCGTTCCACGGCCGCGGGCTGTCCACCAAGGACCTGGTGGTGCTGTCGGGCGCCCACACG
CTGGGCTTCGCGCACTGCTCCTCCTTCCAGAACCGCATCCGGCTCCAGGACCAGGGCACCGACGCCGACGACCCTTCCCTGAGCCCCTCCTTCGCCGCCGCCCTCCGCCGTGCGTGCCCC
GCCAACAACACCGTCCGCGCCGCCGGGTCCGGCCTGGACGCCACCTCCGCGGCCTTCGACAACACCTACTACCGGATGCTGCAGGCCGGCCAGGGCCTGCTCTCCTCCGACGAGGCGCTG
CTCACGCACCCCAAGACGCGCGCCTTCGTCGCGCTCTACGCCGCGTCGCAGGAGGCCTTCTTCAGGGCCTTCGCCAAGTCCATGCTGCGGATGGCCGCGCTCAACGGAGGCGACGAGGTG
CGAGCCAACTGCAGGCGCGTCAACTCATCATGA

Retrieve as FASTA