Entry information : CclPrx85 (clementine0.9_027948m)
Entry ID 8716
Creation 2011-06-25 (Qiang Li)
Last sequence changes 2012-01-04 (Qiang Li)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2011-12-05 (Qiang Li)
Peroxidase information: CclPrx85 (clementine0.9_027948m)
Name (synonym) CclPrx85 (clementine0.9_027948m)
Class Class III peroxidase    [Orthogroup: Prx012]
Taxonomy Eukaryota Viridiplantae Streptophyta Rutaceae Citrus
Organism Citrus clementina    [TaxId: 85681 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value CclPrx85
start..stop
S start..stop
CsPrx23 596 0 1..317 1..323
CclPrx103 589 0 1..317 1..323
CclPrx97 587 0 1..317 1..323
CclPrx117 562 0 1..317 1..323
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 1250934..1251335 402 N° 2 1251495..1251657 163 N° 3 1251804..1252192 389  
join(1250934..1251335,1251495..1251657,1251804..1252192)


exon

Literature and cross-references CclPrx85 (clementine0.9_027948m)
DNA ref. Phytozome 11:   scaffold_15 (1250934..1252192)
Protein sequence: CclPrx85 (clementine0.9_027948m)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   317 (294)
PWM (Da):   %s   33898.17 (31423.8)  
PI (pH):   %s   7.64 (7.98) Peptide Signal:   %s   cut: 24 range:24-317
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MASLSQIIFVSILLLIISTQCEAQLSPTFYDATCPRALKTIRTGIRNAVSGERRMAASLLRLHFHDCFVQGCDASILLDDSSSIDSEKNALPNFKSVRGFEVIDSVKSQLESVCPGVVSCADIVAVAARDASFAVGGPSWTVKLGRRDSTTASRSLAENLPSFTDGLDKLISTFATKGFSARDLVALSGAHTIGQAQCALFRDRIYSNQSDIDAGFASTRRRECPASGGDSNLSPLDLVTPDSFDNNYFKNLVQKKGLLASDQVLFSGGSTDSIVDEYSKNRSKFKSDFAAAMIKMADISPLTGTAGQIRRVCNLVN

Retrieve as FASTA  
Remarks Complete sequence from genomic. The same with CclPrx89 which is located at different locus.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTTCCCTTTCTCAAATAATATTTGTCTCCATATTGTTGTTGATCATCTCTACACAATGTGAAGCACAACTCTCACCAACATTCTATGATGCCACATGCCCTCGTGCCCTCAAAACA
ATCCGAACAGGCATTAGAAATGCTGTTTCAGGAGAGCGTAGGATGGCGGCGTCCCTCCTTCGCCTCCATTTTCACGATTGCTTCGTTCAAGGTTGTGACGCGTCCATTTTGTTGGACGAT
TCCTCCTCCATTGACAGCGAGAAAAATGCACTTCCAAATTTTAAATCAGTTAGAGGATTCGAAGTTATAGACAGCGTCAAGTCTCAACTGGAGAGTGTTTGCCCAGGAGTTGTTTCATGC
GCTGATATCGTTGCTGTTGCAGCCCGTGATGCTTCTTTTGCT
GTGAGTAATTCATCATTAATTTTCTATAAGAAAATTACTATAAGAGACATAGTGCTAATAGAAATAGTGATAAGCCGA
TGCAGTTCGGTATTATTAATCTTAATATATAATTCATCGTTACTTTCGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCAGGTTGGTGGACCATCATGGACAGTTAAGCTTGGTAGAAGA
GACTCAACAACTGCAAGCAGAAGCTTAGCTGAAAATCTCCCTAGCTTTACAGATGGATTGGACAAACTTATTTCCACCTTCGCTACGAAGGGCTTTAGCGCAAGAGACTTGGTCGCCCTT
TCAG
GTACCTCTCTCTCTCTGTATATATATCTTCATCTCGTTATGTGTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNGCTTCGTTTGAAATTCAGGAGCTCATACAATCGGCCAAGCGCAATGTGCACTTTTCCGTGATAGGATTTATAGCAATCAAAGCGATATTGACGCCGGATTTGCAAGCA
CTCGAAGACGTGAGTGTCCGGCTAGTGGTGGTGACAGCAACCTATCACCACTTGATTTGGTGACACCCGATTCTTTTGATAACAATTACTTTAAGAATCTCGTTCAGAAGAAAGGACTTC
TTGCATCAGACCAAGTTCTCTTTAGTGGCGGATCCACTGACTCAATTGTTGATGAATATAGCAAAAATCGTTCAAAATTTAAGTCTGATTTTGCAGCTGCTATGATCAAGATGGCAGATA
TCAGTCCTCTAACTGGCACTGCCGGACAAATTCGAAGAGTTTGCAATCTTGTCAACTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTTCCCTTTCTCAAATAATATTTGTCTCCATATTGTTGTTGATCATCTCTACACAATGTGAAGCACAACTCTCACCAACATTCTATGATGCCACATGCCCTCGTGCCCTCAAAACA
ATCCGAACAGGCATTAGAAATGCTGTTTCAGGAGAGCGTAGGATGGCGGCGTCCCTCCTTCGCCTCCATTTTCACGATTGCTTCGTTCAAGGTTGTGACGCGTCCATTTTGTTGGACGAT
TCCTCCTCCATTGACAGCGAGAAAAATGCACTTCCAAATTTTAAATCAGTTAGAGGATTCGAAGTTATAGACAGCGTCAAGTCTCAACTGGAGAGTGTTTGCCCAGGAGTTGTTTCATGC
GCTGATATCGTTGCTGTTGCAGCCCGTGATGCTTCTTTTGCT
GTTGGTGGACCATCATGGACAGTTAAGCTTGGTAGAAGAGACTCAACAACTGCAAGCAGAAGCTTAGCTGAAAATCTC
CCTAGCTTTACAGATGGATTGGACAAACTTATTTCCACCTTCGCTACGAAGGGCTTTAGCGCAAGAGACTTGGTCGCCCTTTCAG
GAGCTCATACAATCGGCCAAGCGCAATGTGCACTT
TTCCGTGATAGGATTTATAGCAATCAAAGCGATATTGACGCCGGATTTGCAAGCACTCGAAGACGTGAGTGTCCGGCTAGTGGTGGTGACAGCAACCTATCACCACTTGATTTGGTGACA
CCCGATTCTTTTGATAACAATTACTTTAAGAATCTCGTTCAGAAGAAAGGACTTCTTGCATCAGACCAAGTTCTCTTTAGTGGCGGATCCACTGACTCAATTGTTGATGAATATAGCAAA
AATCGTTCAAAATTTAAGTCTGATTTTGCAGCTGCTATGATCAAGATGGCAGATATCAGTCCTCTAACTGGCACTGCCGGACAAATTCGAAGAGTTTGCAATCTTGTCAACTGA

Retrieve as FASTA