Entry information : CclPrx98 (clementine0.9_030435m)
Entry ID 8727
Creation 2011-06-25 (Qiang Li)
Last sequence changes 2011-12-13 (Qiang Li)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2012-01-04 (Qiang LI)
Peroxidase information: CclPrx98 (clementine0.9_030435m)
Name (synonym) CclPrx98 (clementine0.9_030435m)
Class Class III peroxidase    [Orthogroup: Prx022]
Taxonomy Eukaryota Viridiplantae Streptophyta Rutaceae Citrus
Organism Citrus clementina    [TaxId: 85681 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value CclPrx98
start..stop
S start..stop
CsPrx17 745 0 1..391 2..377
PpePrx04 474 1e-168 55..387 1..349
PpePrx50 473 3e-168 57..387 11..344
EgrPrx91 463 1e-163 4..389 8..397
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 257694..257999 306 N° 2 256776..256973 198 N° 3 255291..255456 166 N° 4 254674..255179 506
complement(join(254674..255179,255291..255456,256776..256973,257694..257999))


exon

Literature and cross-references CclPrx98 (clementine0.9_030435m)
DNA ref. Phytozome 12:   scaffold_111 (257999..254674)
Protein sequence: CclPrx98 (clementine0.9_030435m)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   391 (371)
PWM (Da):   %s   43383.53 (41074.2)  
PI (pH):   %s   6.51 (6.18) Peptide Signal:   %s   cut: 21 range:21-391
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MGRWVYVVLVISLILSLRNPKRFDTQTITDDELTHPSLSIFLQRSHFNISQGHELRLEYDYYRDKCPDAEKIVRSKMAQLYSQDKQVPANLLRLFFHDCFIMGCDASVFLDDSNGNESHPIERQAIPSQTLKGFDKINLIKEELEEACPGMVSCADALALATRDGILLAGGPYYPVFTGRRDSIKSYFQEATAEIPGPDDDLNKILHLFSLRGFSPRETVSLIGAHNIGKISCQFIRNRLYDFLGTGQPDPTMSDDFLVEMRVLCGDGNQTSLHGSPAPASAPAPMRSSGMRESTLGMNYYQRLSTSISSGAGFDAHYYQNLLRGRGLLHADQQLMAEEKTAKLVWAYASDCGTAYRTDFARVMLKMSNLGVLSGSQGQVRSNCSLSLNSS

Retrieve as FASTA  
Remarks Complete sequence from genomic. Incorrect prediction from phytozome (Short 5' end is missing).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGGTAGGTGGGTTTATGTTGTTCTTGTAATCTCTTTGATTCTGTCATTGAGAAACCCAAAGAGATTCGATACACAAACAATAACAGATGATGAGTTAACTCATCCAAGTTTATCCATT
TTCCTTCAAAGATCCCATTTCAATATAAGTCAAGGTCATGAACTTCGTCTTGAGTATGATTACTATAGAGACAAATGTCCTGATGCTGAAAAGATAGTGAGGTCAAAAATGGCCCAACTT
TACTCGCAGGATAAACAAGTTCCCGCAAATTTGTTGCGCCTATTCTTCCACGACTGCTTCATCATG
GTATATCATTTTAATCTTTTGGTCACAATTCTTGGGTTTCTGTAGCTTTCTCTC
CAATGGCTTCTGTTCTTTTGCACTAAGTTGCTTTGCCGCTTCTTTTTCCGTATTCTTGTAAGGATTTTCTTCTCTTTGATCCTTTCTAATGATCTTCCTTTTCTAATCTTTTGCCTTTAG
TAGTTCTTTATGAGTATTAATTTCATCCCACTTGATCTTTTCTGGGTTTTTTCGTTTCCATGACTGCTCCATCATGGTGTATTCTTATCTTTTTCGATTCTTGGATTGATGTCAATTTAT
TTCCAATGGGTTCTGTTCTATTGATCATATTTTTGCTTTTCTCCCNNNNNNNNNNNNNNNNNNNNNCTTGTTGGCTTTTGTTCTGGGTTCTTGAAAGGGTTCTGTTCCCTTTGGTCTGCT
GTAATGTGCTTCTTTTTCCTTTTTCAATTTCTATAAATGAGCATTAAGTTTTCGATTCGAAATATTTTCCTAATTTCAGGTGGGTTTGTTCTTTTCTTATTGCTGAAATGGTTGATTACC
ATAATATTCTTTATAGTTTTTATTTGGTTGGGTTTCATCTTTTCTCAATTTCATGATGTTAGGCCTGAACAGACGTATTCATTGGTAAATTTTGCCTTCCATTTTGATTTTTTTAGTCCT
GAACTTTTGTTAGCTCATGATTTTGCTGTTAATTGTTTGTGTCGTTCTGGTGTTTCTTTGAACCAGGGCTGTGATGCTTCGGTGTTCTTAGATGATAGCAACGGCAATGAGAGCCATCCA
ATAGAGAGGCAGGCGATTCCCAGCCAAACTCTCAAGGGCTTTGACAAAATTAATCTGATCAAGGAAGAGCTTGAAGAGGCTTGTCCAGGGATGGTTTCGTGTGCCGACGCACTAGCTCTT
GCCACCAGAGATGGCATCCTTTTG
GTAAGCTTTAATTCTCAGCTATTACTTTGTGTCTGTTCCCCATCTCTCCCCCCCACCCCCCTTCCGCTTTTTTCCTCCTCTAATTNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNAATACAACCTGAAGATGCCTAAAAACATGTTGTTTGAATACTCCGTGGTTATGAACCCCGAACAGTGAAAGAGATTTTATAGCTTGCTTTTGGGTAGAAT
TTTTCTGTATACTTGGAAAGTTCTGGCAGTGACCTTTCCATTTCTTTGTGGAAGGATAATTAGTAATTCAAGAAGATGAATGCTCTCACGACATACTTTATATGTCTCTTTTATGTCTTT
GCTAAGGGTTTGGGACAACTCTGAAAACTGAAATCAGTAACTTAAATATTATTAAGGTATCTCAACTTTGGTATGGTCTTATTAGACAATTTAGAAAATTTTTAAGAATTCAATTATTGG
TATCTGGTTCAACTAGGCGCTAGCTGCTGTGATTGTTATGCTGCAGCTGCTGCTTTTAAATTTGCTGTTTACTATAATTGAAATGAAAAAACATTTGGTTCAACTTACACTTGTCGAATC
CAAAAGGGGAAAACCTTTAAACTATTTTGAAGTACCGATTCTTCTTTATGTTGAACGATATTAATGGATTCTGTTGGACTAAATACCGTAGAAAATTTAAGCATATGCTAGACTTGATGT
GGATCTGATGGGGCAATATCAGGACTCATAGGTTGATATGGCTATCAAGTGCTATAGGATCAGCATAACTTTTCCAGTGTGACTCTTACTTATTGCTGAACTTTTAACAGAAGTAGGCTT
CAAAACTGAAAAATATCATTATTACATAATATATGAAAACTCTTTGGAGATATCTATTGTGTTATTTTTCTTCAACTTCACTGGGTACTATCCTTTTAATTACTTGCAAATCACTTGATG
TCCTATGATTCTGTTATTTGCAGGTTTCTTTCTTAAAATTCTTGTAATTTATTCTTCTCTCTCTCAATCTGTCTCACCCTTTTTCTTCAGCTGATTACAGCTCATATGATTCCATCGGCA
TGGTTTCTGACCTTAGAATCAAATTCATCTCTGCCAAATGATTGAATAGTCGGTTAATTCTTTTGTTTTGAAAATTTTGAAAAAAGACTATATACATTTTCTTTCTTTTTACCTGTTAGT
AAGGTTTCCCTCAGTTTTTCTTGGTTATGTTGTCCTTTTTAAGTTTCATATTTCTCTTGATACCTATTTATGCTATTGGGTTAGCATATGCTTATTTTTCATTGTTATTTAAGCACTCCA
ATGTTTGTGCAATGAAAGAACAGGCTGGTGGCCCATACTATCCAGTATTTACGGGCAGAAGAGACAGCATTAAATCGTACTTTCAGGAAGCTACTGCTGAGATACCAGGACCTGATGATG
ATCTTAACAAGATTCTTCACCTGTTCTCGCTCAGAGGTTTCAGTCCAAGAGAAACAGTCAGTCTAATAG
GTACTCTTTCTATGCTTCTTCCTCCATCTCTTGTGTATCATAAAGTAAATT
AATGCTAAAACATTCGAATTAGAATCATAATTTGAATTTGATATTTTTTGTTATCTGAAGGGGCTCATAACATTGGAAAAATCAGTTGTCAATTCATTAGAAACCGCCTCTATGACTTTT
TGGGGACAGGTCAGCCAGATCCTACCATGTCTGATGATTTTTTAGTTGAAATGAGGGTTCTTTGTGGGGATGGCAACCAAACTAGTCTTCATGGCTCTCCTGCTCCTGCTTCTGCGCCTG
CTCCAATGAGATCTAGTGGAATGCGTGAGTCAACTCTAGGAATGAATTACTATCAGAGATTATCAACTTCCATCTCATCTGGGGCAGGTTTTGACGCACATTACTATCAGAATTTGCTGA
GAGGGAGAGGACTTCTCCATGCTGATCAGCAATTGATGGCTGAGGAGAAGACTGCAAAGCTGGTCTGGGCATATGCATCAGACTGTGGAACAGCCTACAGAACAGACTTTGCCAGGGTTA
TGTTGAAGATGTCAAACCTTGGTGTCTTGTCCGGATCCCAAGGTCAGGTCCGATCAAACTGCTCCTTGTCACTTAACAGCTCTTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGGTAGGTGGGTTTATGTTGTTCTTGTAATCTCTTTGATTCTGTCATTGAGAAACCCAAAGAGATTCGATACACAAACAATAACAGATGATGAGTTAACTCATCCAAGTTTATCCATT
TTCCTTCAAAGATCCCATTTCAATATAAGTCAAGGTCATGAACTTCGTCTTGAGTATGATTACTATAGAGACAAATGTCCTGATGCTGAAAAGATAGTGAGGTCAAAAATGGCCCAACTT
TACTCGCAGGATAAACAAGTTCCCGCAAATTTGTTGCGCCTATTCTTCCACGACTGCTTCATCATG
GGCTGTGATGCTTCGGTGTTCTTAGATGATAGCAACGGCAATGAGAGCCATCCA
ATAGAGAGGCAGGCGATTCCCAGCCAAACTCTCAAGGGCTTTGACAAAATTAATCTGATCAAGGAAGAGCTTGAAGAGGCTTGTCCAGGGATGGTTTCGTGTGCCGACGCACTAGCTCTT
GCCACCAGAGATGGCATCCTTTTG
GCTGGTGGCCCATACTATCCAGTATTTACGGGCAGAAGAGACAGCATTAAATCGTACTTTCAGGAAGCTACTGCTGAGATACCAGGACCTGATGAT
GATCTTAACAAGATTCTTCACCTGTTCTCGCTCAGAGGTTTCAGTCCAAGAGAAACAGTCAGTCTAATAG
GGGCTCATAACATTGGAAAAATCAGTTGTCAATTCATTAGAAACCGCCTC
TATGACTTTTTGGGGACAGGTCAGCCAGATCCTACCATGTCTGATGATTTTTTAGTTGAAATGAGGGTTCTTTGTGGGGATGGCAACCAAACTAGTCTTCATGGCTCTCCTGCTCCTGCT
TCTGCGCCTGCTCCAATGAGATCTAGTGGAATGCGTGAGTCAACTCTAGGAATGAATTACTATCAGAGATTATCAACTTCCATCTCATCTGGGGCAGGTTTTGACGCACATTACTATCAG
AATTTGCTGAGAGGGAGAGGACTTCTCCATGCTGATCAGCAATTGATGGCTGAGGAGAAGACTGCAAAGCTGGTCTGGGCATATGCATCAGACTGTGGAACAGCCTACAGAACAGACTTT
GCCAGGGTTATGTTGAAGATGTCAAACCTTGGTGTCTTGTCCGGATCCCAAGGTCAGGTCCGATCAAACTGCTCCTTGTCACTTAACAGCTCTTAA

Retrieve as FASTA