Entry information : CclPrx[P]95 (clementine0.9_030191m)
Entry ID 8730
Creation 2011-06-25 (Qiang Li)
Last sequence changes 2012-01-04 (Qiang Li)
Sequence status theoretical translation / pseudogene
Reviewer Not yet reviewed
Last annotation changes 2011-12-13 (Qiang Li)
Peroxidase information: CclPrx[P]95 (clementine0.9_030191m)
Name (synonym) CclPrx[P]95 (clementine0.9_030191m)
Class Class III peroxidase     [Orthogroup: Prx014]*
Taxonomy Eukaryota Viridiplantae Streptophyta Rutaceae Citrus
Organism Citrus clementina    [TaxId: 85681 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value CclPrx[P]95
start..stop
S start..stop
CsPrx23 353 4e-124 1..230 1..227
CclPrx117 351 3e-123 1..230 1..227
CclPrx103 347 8e-122 1..230 1..227
CsPrx[P]70 344 9e-122 1..229 1..231
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 1273765..1274131 367 N° 2 1273647..1273698 52 N° 3 1273342..1273610 269  
complement(join(1273342..1273610,1273647..1273698,1273765..1274131))


exon

Literature and cross-references CclPrx[P]95 (clementine0.9_030191m)
DNA ref. Phytozome 12:   scaffold_15 (1274131..1273342)
Protein sequence: CclPrx[P]95 (clementine0.9_030191m)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   229 (201)
PWM (Da):   %s   24746.72 (21732.1) Transmb domain:   %s   i7-24o
PI (pH):   %s   8.59 (8.73) Peptide Signal:   %s   cut: 29 range:29-229
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MASLSQTNFTYTIIAFILLLIISTQCGAQLSPTFYDATCPNALNTIRTGIRNAVSREIRMAAxFIRLHFHD*FVQGCDASILLDDSSSIDSEKNALPNFKSARGFEAIDSVKSQLESVCPGVLRCRSVLLILIYNSLLVLGGPSWTVKLGRRDSTTACRSFAENLPSFTDGLDKLISTFATKGLNAKYSVALSSTSISLSxVGQAQYAFFRERIYNNQNNIDAGFKSTRR

Retrieve as FASTA  
Remarks Pseudogene from genomic. Incorrect prediction from phytozome (3' end is missing with stop and X in frame).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
GGCTTCTCTTTCTCAAACAAATTTTACATATACAATTATTGCCTTCATATTGTTGTTGATCATCTCTACACAATGTGGAGCACAACTCTCACCAACATTCTATGATGCCACATGCCCTAA
TGCTCTCAATACCATCCGAACAGGCATTAGAAATGCTGTTTCACGAGAGATTAGGATGGCGGCATCNTTCATTCGCCTCCATTTCCATGATTGATTCGTTCAAGGTTGTGACGCGTCCAT
TTTGTTGGATGATTCCTCCTCCATTGACAGCGAGAAAAATGCACTTCCAAATTTTAAATCAGCTAGAGGATTCGAAGCTATAGACAGTGTCAAGTCTCAACTGGAGAGTGTTTGCCCTGG
AGTTCTT
TGATCATTAATTTTCTATCAGATTAATACAATAAGAGACATGGTCCTAACAGAAATAGCGATAAGCCGATGCCGTTCTGTATTACTAATCTTAATATATAATTCATTGTTAGT
TTTGG
TTAGTTAATTAATTTGAAAATATTAATTACAGGTTGGTGGACCATCATGGACAGTTAAGCTTGGTAGAAGAGACTCAACAACTGCATGCAGAAGCTTCGCTGAAAACCTCCCTAG
CTTTACAGATGGATTGGACAAACTCATTTCCACCTTCGCTACCAAAGGCTTGAATGCAAAATACTCGGTTGCCCTTTCAAGTACCTCCATCTCTCTCTCTCGNGTTGGCCAAGCACAATA
TGCATTTTTCCGTGAAAGGATTTATAACAATCAAAACAATATTGATGCTGGATTTAAAAGCACTCGAAGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
GGCTTCTCTTTCTCAAACAAATTTTACATATACAATTATTGCCTTCATATTGTTGTTGATCATCTCTACACAATGTGGAGCACAACTCTCACCAACATTCTATGATGCCACATGCCCTAA
TGCTCTCAATACCATCCGAACAGGCATTAGAAATGCTGTTTCACGAGAGATTAGGATGGCGGCATCNTTCATTCGCCTCCATTTCCATGATTGATTCGTTCAAGGTTGTGACGCGTCCAT
TTTGTTGGATGATTCCTCCTCCATTGACAGCGAGAAAAATGCACTTCCAAATTTTAAATCAGCTAGAGGATTCGAAGCTATAGACAGTGTCAAGTCTCAACTGGAGAGTGTTTGCCCTGG
AGTTCTT
CGATGCCGTTCTGTATTACTAATCTTAATATATAATTCATTGTTAGTTTTGGGTGGACCATCATGGACAGTTAAGCTTGGTAGAAGAGACTCAACAACTGCATGCAGAAGCTT
CGCTGAAAACCTCCCTAGCTTTACAGATGGATTGGACAAACTCATTTCCACCTTCGCTACCAAAGGCTTGAATGCAAAATACTCGGTTGCCCTTTCAAGTACCTCCATCTCTCTCTCTCG
NGTTGGCCAAGCACAATATGCATTTTTCCGTGAAAGGATTTATAACAATCAAAACAATATTGATGCTGGATTTAAAAGCACTCGAAGA

Retrieve as FASTA