Entry information : CpapAPx04 (evm.model.supercontig_64.103)
Entry ID 8732
Creation 2011-06-28 (Qiang Li)
Last sequence changes 2011-12-01 (Qiang Li)
Sequence status partial
Reviewer Not yet reviewed
Last annotation changes 2012-01-05 (Qiang LI)
Peroxidase information: CpapAPx04 (evm.model.supercontig_64.103)
Name (synonym) CpapAPx04 (evm.model.supercontig_64.103)
Class Ascorbate peroxidase     [Orthogroup: APx002]*
Taxonomy Eukaryota Viridiplantae Streptophyta Caricaceae Carica
Organism Carica papaya    [TaxId: 3649 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value CpapAPx04
start..stop
S start..stop
StAPx07 252 2e-85 1..187 1..203
LeAPx07 246 2e-82 1..187 1..203
GmAPx08 243 5e-81 40..187 36..203
CpapAPx05 236 9e-80 65..187 1..144
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 724652..724819 168 N° 2 724357..724497 141 N° 3 723796..723916 121 N° 4 723682..723724 43
N° 5 723440..723533 94  
complement(join(723440..723533,723682..723724,723796..723916,724357..724497,7246 52..724819))


exon

Literature and cross-references CpapAPx04 (evm.model.supercontig_64.103)
DNA ref. Phytozome 11:   supercontig_64 (724819..723440)
Protein sequence: CpapAPx04 (evm.model.supercontig_64.103)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   188
PWM (Da):   %s   20012.44  
PI (pH):   %s   10.39
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MASSLGTVASSRLLSSSKARLCLSSSSSSPSISTLSLSSLRCLSSSPLISRLSLNQRSFVNVSNGGFSTVATAKSAASDPDQLKSAKEDIKELLRTKFCHPILVRLGWHDAGTYNKNIEEWPQRGGANGSLRFEVELKHAANAGLVNALKLIQPIKDKRLGVQKSPMKYGRVDASGPDQCPEEGRLPG

Retrieve as FASTA  
Remarks Partial sequence from genomic. Incorrect prediction from phytozome (A big gap in frame due to the NNNNNNNNN in DNA sequence).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCGTCTTCTCTTGGCACCGTCGCTTCATCACGCTTACTCTCCTCCTCTAAAGCCAGACTCTGTCTCTCCTCCTCCTCCTCCTCCCCGTCTATATCTACACTCTCTCTTTCGTCTCTC
AGATGTCTCTCTTCCTCCCCTCTCATTTCTCGTCTCTCTCTCAATCAG
GTTTCACCTCTCATTTCTATTTTTCTATCTCCCTATCTATGTTTATATTTGTGATATTTGATTGTTGTGATC
GTTTCCTTCTAGAATACGTGGTTATGGGTTTATTCATTTGCTTTGCTTGCTTATTTGTATTTATTTTTGGTGATTTTTGAAGAGATCTTTTGTTAACGTGAGCAATGGAGGTTTTAGCAC
TGTGGCTACTGCGAAATCTGCAGCTTCTGATCCCGATCAGTTGAAGAGTGCCAAGGAAGACATCAAAGAGCTACTCAGGACTAAGTTTTGCCATCCTATCCTG
GTATGATTTTAATTTGG
TTTACATACAGTCTACAATAATACACAAACATACTACATGTGCATGTGCTTTTTAGGTGAATTGAACCAGTAATTGATTCGCGAGGTTAATAATTTTGCATTTGATTATTTTCTTTATAA
TCTTGTTCATGGGATTTGCCAGCTTTATATTCTTAATTTTCTTGTTTAGTTTAACGCTCTTCGGAATTGCATAACAATTCTAATCTTCGAGTACTTTTCATTCTTTCCTTACTTCTTCTT
GGAAAAAAAAAAAAAAAACCGAAGACCAGCTCCTTGATAACAGTACTTTGTTTTCTTAGTTTCCTTACTGTAATATGTTGGACTTATCTTTTCCTGCTGTTGACTGGAAGATTCGAGGAG
TAGATTGCAGGAGCTTGTTAAGAACTGAACTGTTTTATCATCTGAAATAATTTTGTACCACAGGTTCGCCTGGGCTGGCATGATGCCGGTACATATAACAAAAACATTGAGGAGTGGCCA
CAGAGGGGTGGAGCTAATGGGAGCCTTAGATTTGAAGTTGAACTAAAGCATGCAGCCAATGCCG
GTAATTTTTTGACTTTGATATATTATGTGGGTTGGCTGATCCTGCTCTGACTCGGT
AGCTGGCTTTTTCAGGTCTTGTGAATGCATTAAAACTAATTCAGCCCATCAAAGATAAGTACTCTGGTGTCACATACGCAGACTTATTTCAGTTGGCCAGTGCCACTGCAGTGGAGGTTC
TTATTGTTCCAATTCTTAGATATATATCTGTAGCATTAACTTCTTTTGAACAATTAAAGATCTACTGGTGAACCTTGTTTATTCAGGAGGCTGGGGGTCCAAAAATCCCCCATGAAATAT
GGAAGAGTGGATGCATCGGGGCCTGATCAGTGCCCTGAAGAAGGGAGACTTCCTGGTTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCGTCTTCTCTTGGCACCGTCGCTTCATCACGCTTACTCTCCTCCTCTAAAGCCAGACTCTGTCTCTCCTCCTCCTCCTCCTCCCCGTCTATATCTACACTCTCTCTTTCGTCTCTC
AGATGTCTCTCTTCCTCCCCTCTCATTTCTCGTCTCTCTCTCAATCAG
AGATCTTTTGTTAACGTGAGCAATGGAGGTTTTAGCACTGTGGCTACTGCGAAATCTGCAGCTTCTGATCCC
GATCAGTTGAAGAGTGCCAAGGAAGACATCAAAGAGCTACTCAGGACTAAGTTTTGCCATCCTATCCTG
GTTCGCCTGGGCTGGCATGATGCCGGTACATATAACAAAAACATTGAGGAG
TGGCCACAGAGGGGTGGAGCTAATGGGAGCCTTAGATTTGAAGTTGAACTAAAGCATGCAGCCAATGCCG
GTCTTGTGAATGCATTAAAACTAATTCAGCCCATCAAAGATAAGAGGCTG
GGGGTCCAAAAATCCCCCATGAAATATGGAAGAGTGGATGCATCGGGGCCTGATCAGTGCCCTGAAGAAGGGAGACTTCCTGGTTAG

Retrieve as FASTA