Entry information : CpapAPx05 (evm.model.supercontig_64.102)
Entry ID 8733
Creation 2011-06-28 (Qiang Li)
Last sequence changes 2012-01-05 (Qiang Li)
Sequence status partial
Reviewer Not yet reviewed
Last annotation changes 2011-11-30 (Qiang Li)
Peroxidase information: CpapAPx05 (evm.model.supercontig_64.102)
Name (synonym) CpapAPx05 (evm.model.supercontig_64.102)
Class Ascorbate peroxidase     [Orthogroup: APx002]*
Taxonomy Eukaryota Viridiplantae Streptophyta Caricaceae Carica
Organism Carica papaya    [TaxId: 3649 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value CpapAPx05
start..stop
S start..stop
CclAPx02 444 2e-158 2..255 45..345
CsAPx05 441 2e-157 2..255 43..343
VvAPx06 441 1e-156 2..255 71..374
GmAPx08 433 1e-154 1..256 62..366
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 724357..724473 117 N° 2 723794..723916 123 N° 3 723624..723725 102 N° 4 723446..723533 88
N° 5 717882..717956 75 N° 6 717720..717797 78 N° 7 717541..717645 105 N° 8 716388..716462 75
N° 9 716236..716241 6  
complement(join(716236..716241,716388..716462,717541..717645,717720..717797,7178 82..717956,723446..723533,723624..723725,723794..723916,724357..724473))


exon

Literature and cross-references CpapAPx05 (evm.model.supercontig_64.102)
DNA ref. Phytozome 11:   supercontig_64 (724473..716236)
Protein sequence: CpapAPx05 (evm.model.supercontig_64.102)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   256
PWM (Da):   %s   27610.98  
PI (pH):   %s   5.06
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
RF*HCGYCEICSF*SRSVEECQGRHQRATQD*VLPSYPGSPGLA*CRYI*QKH*GVATEGWS*WEP*I*S*TKACSQCR*SCECIKTNSAHQR*VLWCHIRRLISVGQCHCSGGGWGSKNPXHEIWKSGCIGA*SVP*RRETS*RWARSTRRTILDSAMAEV**FLLQGD*RKEG*RSACIAN*CCSL**PFIQGVCREIC*RSGCILQGLC*SPC*AQHPWGQV*SSRGYCTR*WSYQSCTRKVCGSKVLIWKX

Retrieve as FASTA  
Remarks Partial sequence from genomic. Incorrect prediction from phytozome (5' end is missing; A gap in frame due to the NNNN in DNA). complement(join(716236..716241,716388..716462,717541..717645,717720..717797,717882..717956,723446..723533,723624..723725,723794..723916,724357..724473))
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
AGGTTTTAGCACTGTGGCTACTGCGAAATCTGCAGCTTCTGATCCCGATCAGTTGAAGAGTGCCAAGGAAGACATCAAAGAGCTACTCAGGACTAAGTTTTGCCATCCTATCCTGGTATG
ATTTTAATTTGGTTTACATACAGTCTACAATAATACACAAACATACTACATGTGCATGTGCTTTTTAGGTGAATTGAACCAGTAATTGATTCGCGAGGTTAATAATTTTGCATTTGATTA
TTTTCTTTATAATCTTGTTCATGGGATTTGCCAGCTTTATATTCTTAATTTTCTTGTTTAGTTTAACGCTCTTCGGAATTGCATAACAATTCTAATCTTCGAGTACTTTTCATTCTTTCC
TTACTTCTTCTTGGAAAAAAAAAAAAAAAACCGAAGACCAGCTCCTTGATAACAGTACTTTGTTTTCTTAGTTTCCTTACTGTAATATGTTGGACTTATCTTTTCCTGCTGTTGACTGGA
AGATTCGAGGAGTAGATTGCAGGAGCTTGTTAAGAACTGAACTGTTTTATCATCTGAAATAATTTTGTACCACAGGTTCGCCTGGGCTGGCATGATGCCGGTACATATAACAAAAACATT
GAGGAGTGGCCACAGAGGGGTGGAGCTAATGGGAGCCTTAGATTTGAAGTTGAACTAAAGCATGCAGCCAATGCCGGTAA
TTTTTTGACTTTGATATATTATGTGGGTTGGCTGATCCTG
CTCTGACTCGGTAGCTGGCTTTTTCAGGTCTTGTGAATGCATTAAAACTAATTCAGCCCATCAAAGATAAGTACTCTGGTGTCACATACGCAGACTTATTTCAGTTGGCCAGTGCCACTG
CAGTGGAGGT
TCTTATTGTTCCAATTCTTAGATATATATCTGTAGCATTAACTTCTTTTGAACAATTAAAGATCTACTGGTGAACCTTGTTTATTCAGGAGGCTGGGGGTCCAAAAATCC
NNCCCATGAAATATGGAAGAGTGGATGCATCGGGGCCTGATCAGTGCCCTGAAGAAGGGAGACTTCCT
GGTTAGTGAACCATATTTTTCTTGATGACATGTAGTTTGACAAATTCCATCT
TGGTGTCCTTGTTGATTCTGCTGGATCATTACAAGATCATGCTGCCACCTGCTCACATAAATTAGATATTGACATTTGAAACATGCTAAGCTCCGTTCTAAGTAGAATTACATCAACAGC
ACAAAAGTATCATATTGACATGTCATGACCATGCATATTAACATAGTTCATAGCTCTGGTGTTTCATGTGATTTTTGCTTGATTATCTTTGCTACTCTAGAATAAATGAAGAACACATCT
GTCTTTTCAGAGTCTTCAGATTACAAGGCTAACTTTCAAATCATTTACTTAGTCATAGAAGAATTAAGAGAGCATTTGGTTTCCAGCAGGTAGGTGTTGATTAATGAAGCATTAAGCATG
TTTGCACCTAAGGATAGTTCTAGCAGTTCTCATTTTCTAGAGCCACAAGGCCCTGTTGCTTATTCCACGACTATTATCTATAAGATCCTTGTTCATTTTTGGATTAAGTAGGGAGGAACG
AAGTTGAATTAACACGCAAATAAAGGATTGAGTTTTTGTTTTCCTATGTATTCGAACTATGAAGAGTGCCAATGGAGTTTACAGTTGGATGCCTTACATGGTCGATATCAGTTGTCACAA
TCTTACTTATGTGTAGGTAATGCAGAATATGAAGCTCATGATAACTAGAGAGAGAACCTTCTAGCGAGAGAAAGAGAGGGCGAGTGTGTTGCTTAGGTGGGCATGGAGTAGGAAGGTAAA
AGGGAAAAAGGGTAGGTAGATTGAAGAGGAGGAAGCAGGAAGTTAGGTCGGCCACTCGGGCCGACTAGGAGGGGGCGGAGAATATGGTGGCACACCGAAGGAAGTTCCTAGTAATAGATA
ATAAATCTTTCGATGTGGTCTGTGAGGGGCAGAAGATGGAAGGTATGAGGATTAGTGAGAGCGGAAGAGGATTCTGGGTATGAATCTCGTTGGAGAAAGAGGAGGAGGAGTGGTTAATGG
ATGCCTTTGAAGACTTCTATCGAAGAAATGTAGGGAAGACATGGGGAAAGCATACGACAAGTGGCGCTGGGACAAAATCAAAATGGGAGATTCCTTGTGCTAACAGGGGAGAGAGGGCGA
GCAGTGACGCAGGAGATTTTCAAGGACATGCATTCTATTTCGATCTTGGGTCAAACTAGTTTTGTTATTTGAAACATGAGCATGCATATGGTGTGAAGTAGATGGTATCAATATGTACAA
TAGTGTGAATGTTGCTGGAGCATATATTGTTTTCATTGGGATCCTTGATTATTTCTATACGTTAGCTTTTATTGAGTTCAAGTTTTATGTATTTTGTGTTTCTTCTGGATAAATTAAACA
ACTAACTTCTTAAGATAATTTATTTTATGTTTAGATTCTTAGTTCCAATTGCCTGTTGATCGTTATAACTATGTGAGTCCCCCGAGATGCAAGTGTTATTCCATTCAGATCCTCAATCAT
CTTTTTTTAAAAAATAAAAATGTGAATCAATATATTAACAAGCACTGAGAAGATGTCAACCGTATAAAAAAAATTTACACATTATCAAAATGTCAATAATATCTCCACAATCCTCCAGAG
AATATCGAGAATGACTCAAAATAAAAAATTCAAGAGTTTGAAATCATCTATTTCTAATCCTATCAAAATTCCCTACATCATTTACTCCTTCAAAAACTCTTTTGTTCCTCTCATTTCAAA
TTATCCTAAAGATGGTAGGTGGGATAAGCTCCACATTTTTCCTCTGCCCACTGATATCCTTACACGTCCATATTTCATCTCTACCCGAATCTGCCACCACCCAATTGATACCGAATAATC
GTAAACAATAGACCATAGTTTCTATGCAATCGGGTACCATAGAAAAACATGATTTACAAAGTTCTGCAATCTTTTTACACAAGTAGCACCCATTCACCATAGTCATTCCCCTCCTTATCA
ATTTAAAAATAGTTGGGATGCACCCTCTTATTGCCTCTCATGTAAAGAAAGTCACTCTGAGAGGGACTTTAACCTTCCATATTTGTCTAAAAAGGAAAACCAAAACCAGAGCATTCCTGC
TTAGTCAGATGCTCGTAGAATGATCTGACCAAAAAGAATCCTGTAGTAGTAGGACTCAAAAGAGGTTGATCATTGCTGCTGTCCGAAGTTATAGAGACAAAATAGTTAGGAGATTCTCAT
ACTCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGTAATTTAAGTACCAGATGAAACAACTGCTATAATCTCTGTACTCAG
TCTAGCAAAAAGCTTCTGTTACCTTTACCATAAGCTTACAGAGACAAAGCACCAGCAAAGACTGTAAGCATAAATAAAAAAATGTCTAGTTCAGGGCAAAAAAACAGTGTCTAAGTGAAG
GTAGTTGTAACTTCGGGGGATTTATACCATCTGATGGCATGAAATGAGCTCAAGAAGCCACCATCTTTAGGCAGTTTGGGTTTGCGGTCTTTGGTGGAAACTAATGAGACACTGCAAGGT
ACTTGGTTATGGAGGTGTATGATAGAGGAGGGAGCATTTTGGAGAAGGATCATTGCAGCTAAATTTGATATTAATGAGAGAGGGTGATTTACCATAATGGGGTCAAGACCTCATGGAAAG
AGTGTGTAGAAAAAGATCGGGGCAGATCAAGAAAAGTTCCAAGCACGCATCAGGTGGAAGATTGGGGGGGGGGGGACAAAGTCAAATATTGGGACGATAAGTTGATGGAAGGAGGTATAC
TCAGGACTCAATATCCTCAGATCTTCGCTATAGCTCAGTAGGAAGATGTAAAGATTAGTGATTCTTTCATGGAAGTGAGAGGGGAGAGAAGGAACAGCATGTTTTTGTTTCAAGAAATTT
GAATGGTTGGGGGATAGATGAATATGAGAAGTTGTTAAGTACTCTTTCACTCGTGACTTTGGATGGTAGCAATGATAACCCTTAATAGAGTTTTACTAAGAATGAGTCTTTCACGGGCAA
GTCTTACTACAAGCAGTTGTTCAGGCATGAGGAAAATGGTATTAGATTCCTAAACAGACAAATCTTAAAGGCAAGAGTTCCACCCTATGTTTTGTTTTTTTACATGGGAGGCCAACAGGG
AATGCATTTTAACAATTGATAAGTTGACGAGACGGGACCAAATTTTGGTGAATGCTTGTTATCTTTACAAGAAAGAAGGAGCAATATAACCACGTATTGCTCTAGCGTTGAATGGTTCAC
GAATTTTGGACCATGGTTTATGGGCTTTTGGACATTAGTTGGGTGATAGCTGGATCTGTGAGAGATGAAATTCGGGCGTGGATGGGCATCAGGGGATGGAAGAAATAAGCGGATTTAATA
CCACTTACTATATTTTGGCGAGTGTGGAAGGAGAGGAATTAAAGGGCTTTTGATGAGGTAGATGATGTGAATGAGTTTGACGTACTTAAGAATAGATTGTTACAGATACTTGATTTTTTG
TTATTGGTCATTCTCCAAAGTCGATGAAGGATTTAGGGGACCTTATTGGCACTTTGATAAGCATATAAATTCTTTTGTATATTGGCTGACACTCCCTTAGTGCCCATATTAATACTATAT
GTTACACTTTTTATTTTAAAAAAAAAAATCGGGGGATTTATACCATATCTTTCTCAATGTCCAGCTTGTGTATTGATTGGATGATCATAAGATCTTGGACCTCCAGTAGTTTGAGTTATC
CAGGGCACAATACTCTTCATTGCTTGTTAGTTTTTTGTCCTCTTAAGGTTAACTATAAAATGCCTCCTTCATCACCTCGTGGTTCGCAATGTCAAGTCATTGTCTGTCAGCAGGCATATA
GTCCATGTTAAATAAAACACTTGATATTGACACTCTTTTAGTGAAACACATAACTCTTAAGGTTCCTCAAGTTGCTAGGTAGAGTTGGACTCTCAATTGCACCAAAAAAAAAAAACTTTT
TGTGCTTAAAACAGCGAATAATTAATGCGAGTTAGGTGCATTGATGAGGTTTATTTTTTATGCTTGTTGCTAGTAGATGATTTTCTCGTTTGAACAGCAAGAACTGCAACCTAGATATTA
CTAATACTTTTTCAGAGAAAAGGAAGACATTTTTTTAGCAAAAAATAAAAGAAGATATCCTTGTATGTTTATTTTATTGGTCATTTCAATATTGGTCCCTTTGTCTGGAATGGTACCTTG
GCATGAGAAATAGTTAGAGCCTCAAGAATATGATGGCATATGTTCCTTAATGTTAAAGGTGCAGAAAGTTAGACCATTTGGTTTCCTATACAATGTCATATTGGTACTAAGTAATTCAAG
AAGCCATTTCCTGCCTTCATTAGCCAACTTGGCAGGCATGTATTCCGTTACAGATGGATATCAAGGACTCAAGACTTGTTTATCTTGTTTTTGTAATAGAAAATACTTGGTCTTTAACAC
AATGTCTGGATTGGAGGGAAGTGGAAGGAAAAGAAATCAAATAAAGAGATACTCTCTTTTCACTTGTTTGACAAAAAATAATAATTAGTAAAAGAAAGGGGGAGAGATGACGAGTGTCCT
TTCTTTTTCCCTTAAAACTCTTGACTTTTTCCATTCTTTTTAATTGAGGGAAAGAAAGGGAAAGGAAAGGCTTAAACAATTTTGAAGAAAACATTTCTATTTATTCTTACTAACTAGTAG
TTAATATAACTAATCATTTCATTAACTTTATAAAGATAAACAAATAAAATCCAATAATCTTTTGTGTTGTTTTACTTTTAAAAATTTTAGTTATCTAGGCAAGAAAAATATTTTTCATTT
TTTGTTTCTATAGAAACCATTATTTTCCTTAGCTAATTTCTAAACAAACATAGTGTAATGTTAACTTCATATGAGTACTAATCGCTTCTTGAATATGAACGGGATCAATCACTAATTATT
TAATCACTTTTGTTAGTCCTGTTAATTATCTTTTGTGGTTTAGAGAACTTTCTACCTGTGCATCATAATCAGGAAATTTTATATACATTTTGTCATGTTTTATTCAAACATTATTTTTTG
TTCTGTTAATTCTATAGGCAAGTGATAAGTTACCTGTTTTTGTTTTGTTCAATCTTTTTTGACGGAGGTCAATGAGGGGGATAGTTTATGCTTCTTGTAGTTAGCTGCAAAATTGCTATA
ACCATGAAAAGAACTAAAACAATGTGTTGAATGACAGAAAGATGGGCCCGGAGCACCAGGAGGACAATCCTGGACAGTGCAATGGCTGAAGTTTGATAATTCCTACTTCAAGGTTTGAAC
TTAACAGATAGGCCATTTTCATAATTGATTTCTCCGTTTCTGATTGCAAATTGTTTCCTTTTTTTTTTTCCTACAGGAGATTAAAGAAAAGAGGGATGAAGATCTGCTTGCATTGCCAAC
TGATGCTGTTCTCTTTGATGACCCTTCATTCAAG
GTTGGGAAAACTTTTAAATCACAGAGAAATATGGAAACATATTTTTTGGAAGCTAAATGTTATGTTGTCTGCAGGTGTATGCCGAG
AAATATGCTGAAGATCAGGATGCATTCTTCAAGGACTATGCTGAAGCCCATGCTAAGCTCAGCACCCTTGGGGCCAAGTTTGATCCTCCAGAG
GTTTGTAAACTGTAGTTCTTGTGTCTT
GTGGTTTGTGGATGATGCCCATGAAGTGCTACCCAAACTACTTAATCTATTAGTTAATTTACTTAGAACTGATATTTGGAAAAAACTGTTTTTGTAGAATAGATTTGAAAATGTATAGTT
GTTCAATCAATGAAAATTCAACTCCAGATGAATCCAAGTAAAACTGAAAGATAATCGAATTTCAGTTCCACTTGGAATTTACTTGGAGTTGAACTCTTTTCTTTAAATTTTCATTCTCTT
ATGATAGAGCTAAAAATATAATTCTTAATGAATTCAACAGAAATAGTTTAATTGTTCCAAACATACTCTAGAAGAGAAAGAAAAAATTGTCCATAAAATTGTACATAACTCAAGTGTGAC
CCAACTTGGTCTATTGTATATCCTTTTTCATTTGTCTAAAACTTGAGAAGACATGAATCATCTTCAAACATTTGTTACTAGTGTATAAAAAAAACAAGTACTATGAGTGGTTAATGTATA
TAATAACAATTGTGGAAGTGTATTACTGGCATCTCAATGGTAGAAATGAGTTCACATTTCTAGTGCTAAAAACTTGAAGGTGTAATATTTTAGGGTACTATTAATTATTTATGTTAACTG
CACATCAAGGCATCTAAAGTAAATATATCACCTTCCTAAAAAAAAGCAAAAAATAAATAAACAAACAAAGCCACTTGGCATAGTTTTTGAGGAAGTTTGTTAATTTATTTTTTTTCTGGA
ATTTGTTAATTTCTTTTAACTGTAAGTCAAGGATCGATTAGTTGAATTGGATGGTTGCATCTGCCAGTAAATAAGTAGTCAGTTTTTTCTCTTTCGATTTGCTATTAGCAGTCTAATTGC
TCATTAGCATTGTTCTTGTCAATATATATGATGTTAGAAACGTCAATATATATGATGTTAGAAACATGTCTTGTTTTCGTCTATTGAGGTAACAGCCCCAAAATTATGACAGTTTTTCTT
CCTAACTTATAAATTTGCACGATTAGATTCAACTTAAGTGAATTTTGAAATTGGGGGCATGAAAAACTGACTGTTTGATTTGGTGGTTCAGGGTATTGTACTAGATGATGGTCCTACCAA
AGCTGCACCAGAAAAGTTTGTGGCAGCAAAGTACTCATCTGGAAAG
GTTGTAATTAACAACTTGTTTCATAATATCTTTCCAGTTATTGATTCTGAATGGTTCCTTACATTTTTCTACCT
GAAAGATTTCTGTGGAGGAAACGACGTTTGTGCAAAATGTTCATCTTCTTTACTCTTCATGGTTTCCTGCAGGATTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
AGGTTTTAGCACTGTGGCTACTGCGAAATCTGCAGCTTCTGATCCCGATCAGTTGAAGAGTGCCAAGGAAGACATCAAAGAGCTACTCAGGACTAAGTTTTGCCATCCTATCCTGGTTCG
CCTGGGCTGGCATGATGCCGGTACATATAACAAAAACATTGAGGAGTGGCCACAGAGGGGTGGAGCTAATGGGAGCCTTAGATTTGAAGTTGAACTAAAGCATGCAGCCAATGCCGGTAA
TCTTGTGAATGCATTAAAACTAATTCAGCCCATCAAAGATAAGTACTCTGGTGTCACATACGCAGACTTATTTCAGTTGGCCAGTGCCACTGCAGTGGAGGTGGCTGGGGGTCCAAAAAT
CCNNCCCATGAAATATGGAAGAGTGGATGCATCGGGGCCTGATCAGTGCCCTGAAGAAGGGAGACTTCCT
AAAGATGGGCCCGGAGCACCAGGAGGACAATCCTGGACAGTGCAATGGCT
GAAGTTTGATAATTCCTACTTCAAG
GAGATTAAAGAAAAGAGGGATGAAGATCTGCTTGCATTGCCAACTGATGCTGTTCTCTTTGATGACCCTTCATTCAAGGTGTATGCCGAGAAATA
TGCTGAAGATCAGGATGCATTCTTCAAGGACTATGCTGAAGCCCATGCTAAGCTCAGCACCCTTGGGGCCAAGTTTGATCCTCCAGAG
GGTATTGTACTAGATGATGGTCCTACCAAAGC
TGCACCAGAAAAGTTTGTGGCAGCAAAGTACTCATCTGGAAAG
GATTAA

Retrieve as FASTA