Entry information : CpapPrx04 (evm.model.supercontig_119.101)
Entry ID 8740
Creation 2011-06-28 (Qiang Li)
Last sequence changes 2011-10-03 (Qiang Li)
Sequence status partial
Reviewer Qiang Li
Last annotation changes 2012-01-05 (Qiang LI)
Peroxidase information: CpapPrx04 (evm.model.supercontig_119.101)
Name (synonym) CpapPrx04 (evm.model.supercontig_119.101)
Class Class III peroxidase     [Orthogroup: Prx006]*
Taxonomy Eukaryota Viridiplantae Streptophyta Caricaceae Carica
Organism Carica papaya    [TaxId: 3649 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value CpapPrx04
start..stop
S start..stop
PtPrx101 256 7e-86 9..199 7..199
HbPrx01 253 8e-85 23..199 23..199
PtPrx98 253 1e-84 8..199 13..201
CpapPrx05 252 2e-84 6..199 7..201
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 680037..680258 222 N° 2 679762..679953 192 N° 3 679244..679441 198  
complement(join(679244..679441,679762..679953,680037..680258))


exon

Literature and cross-references CpapPrx04 (evm.model.supercontig_119.101)
DNA ref. Phytozome 12:   supercontig_119 (680258..679244)
Protein sequence: CpapPrx04 (evm.model.supercontig_119.101)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   203 (177)
PWM (Da):   %s   22428.32 (19557.9)  
PI (pH):   %s   5.61 (5.66) Peptide Signal:   %s   cut: 27 range:27-203
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MPSFDHFTLFAALLFATSFLVSPTTQHRLSPTFYDETCPNVITIIREILQDALKFDPRMGASLIRLHFHDCFVNGCDGSVLLDNSFTIESEKDSSPNKNSLRGFEVIDRMKSELECVCPGTVSCADILTIAAEESVYLAGGPPWRNLLGRRDCLTTNKTHANSALPSPFETLDELKAKFSVVGLNKRRDLVALSGILLFFSYL*

Retrieve as FASTA  
Remarks Partial sequence from genomic. Incorrect prediction from phytozome(3' end is missing because of the 'NNNNN' in DNA seq).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCCTTCCTTTGATCACTTCACACTTTTTGCAGCTCTACTCTTTGCTACTTCCTTCCTCGTATCCCCGACAACACAGCATCGGTTATCCCCAACATTTTACGATGAAACATGCCCAAAC
GTAATTACCATCATACGAGAAATCCTTCAAGACGCTTTGAAGTTCGATCCCCGTATGGGTGCCAGTCTCATTCGGCTTCATTTCCATGATTGTTTCGTCAAT
GTATGTGATGATAATTCC
ATGCTAATATTCATCTATTGTTTTATACACATGGTTACGTATGCATCGGTATAATTTCGTTACAGGGTTGTGATGGGTCCGTTCTATTGGACAACAGTTTTACTATAGAGAGTGAGAAAG
ACTCTTCCCCAAATAAGAATTCTTTAAGAGGGTTTGAAGTCATTGATAGGATGAAGAGTGAACTGGAGTGTGTTTGTCCAGGCACTGTTTCTTGTGCAGATATTCTCACAATTGCAGCTG
AAGAATCTGTTTATTTG
GTATGTTAAATTTATTTACAACATCAACCCTCTAGTTTCCTTTTTTTTCTTATCAATTAGATTCATTAGTTTCCTTTTTCTGTAACTTAGATTCAAGAAAGAA
AGAAGGCTTTTTATAAGTTCTGGGTGTACAAGTTTTTTAGTGTCTAAAAATTAATCAATTTAGAAAATAAACATTCGAAACAATTTTGCAATCTTTTCGTCGAACTAAGTATAGATTTAT
AAATAATTTTTATAAGATCTTTAAATTTATTCTAATCACAATTTAAGTAAATTTTTTTTTTATTATTTTAAATGAAATTTTATGTTGATCGTCACAGGCAGGAGGTCCTCCGTGGAGAAA
TCTATTAGGACGAAGAGATTGCTTAACAACAAACAAAACCCATGCGAATTCAGCACTTCCTTCTCCTTTTGAAACTCTTGATGAACTCAAAGCTAAATTCTCAGTCGTTGGCCTCAATAA
ACGCAGAGATTTAGTCGCGCTCTCTGGTATTCTTCTTTTCTTCTCTTACTTATAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCCTTCCTTTGATCACTTCACACTTTTTGCAGCTCTACTCTTTGCTACTTCCTTCCTCGTATCCCCGACAACACAGCATCGGTTATCCCCAACATTTTACGATGAAACATGCCCAAAC
GTAATTACCATCATACGAGAAATCCTTCAAGACGCTTTGAAGTTCGATCCCCGTATGGGTGCCAGTCTCATTCGGCTTCATTTCCATGATTGTTTCGTCAAT
GGTTGTGATGGGTCCGTT
CTATTGGACAACAGTTTTACTATAGAGAGTGAGAAAGACTCTTCCCCAAATAAGAATTCTTTAAGAGGGTTTGAAGTCATTGATAGGATGAAGAGTGAACTGGAGTGTGTTTGTCCAGGC
ACTGTTTCTTGTGCAGATATTCTCACAATTGCAGCTGAAGAATCTGTTTATTTG
GCAGGAGGTCCTCCGTGGAGAAATCTATTAGGACGAAGAGATTGCTTAACAACAAACAAAACCCAT
GCGAATTCAGCACTTCCTTCTCCTTTTGAAACTCTTGATGAACTCAAAGCTAAATTCTCAGTCGTTGGCCTCAATAAACGCAGAGATTTAGTCGCGCTCTCTGGTATTCTTCTTTTCTTC
TCTTACTTATAA

Retrieve as FASTA