Entry information : CpapPrx05 (CpPOD1 / evm.model.supercontig_119.98)
Entry ID 8741
Creation 2011-06-28 (Qiang Li)
Last sequence changes 2011-10-03 (Qiang Li)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2012-08-14 (Christophe Dunand)
Peroxidase information: CpapPrx05 (CpPOD1 / evm.model.supercontig_119.98)
Name (synonym) CpapPrx05 (CpPOD1 / evm.model.supercontig_119.98)
Class Class III peroxidase    [Orthogroup: Prx005]
Taxonomy Eukaryota Viridiplantae Streptophyta Caricaceae Carica
Organism Carica papaya    [TaxId: 3649 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value CpapPrx05
start..stop
S start..stop
CpapPrx03 596 0 1..347 1..347
CpapPrx06 548 0 2..347 3..348
HbPrx01 497 2e-178 10..346 8..344
MePrx115 470 5e-168 10..347 8..343
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 666440..666667 228 N° 2 665990..666181 192 N° 3 665687..665855 169 N° 4 665117..665571 455
complement(join(665117..665571,665687..665855,665990..666181,666440..666667))


exon

Literature and cross-references CpapPrx05 (CpPOD1 / evm.model.supercontig_119.98)
DNA ref. Phytozome 11:   supercontig_119 (666667..665117)
Protein sequence: CpapPrx05 (CpPOD1 / evm.model.supercontig_119.98)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   348 (318)
PWM (Da):   %s   37427.83 (34249.2)  
PI (pH):   %s   4.9 (4.57) Peptide Signal:   %s   cut: 30 range:30-347
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MSSSTLHFCLAATALFFTAFLRGPSLSHAQLSPTFYDVTCPNVTNIIRDIISKELQTDPRITASLNRLHFHDCFVNGCDASILLDNSPTIESEKEALANNNSLRGFDVVDRMKSRLESACPGIVSCADILTIASQLSINLSGGPSWTNLLGRRDSLTASRALANLTIPSPFDTLDQLKQRFINVSLNGDTDLVALSGAHTFGRARCLGFSPRLFNFNNTSAPDPTLNTTFLPVLQQICPQGGNQSVITDLDLTTPNTFDNAYFSNLQIGKGLLQSDQELLSTPGADTANLVNQFSSNTTAFFEAFVLSMIRMGNLSVLTGTAGEIRLNCRVINGVSTLSDDNLVSSI

Retrieve as FASTA  
Remarks Complete sequence from genomic. Incorrect prediction from phytozome(An extra seq in 5' has been removed).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTCTTCTTCCACCCTTCACTTCTGCCTTGCAGCTACAGCTCTTTTCTTTACGGCTTTTCTCCGTGGACCTTCCCTGTCTCACGCTCAATTATCTCCTACGTTTTACGACGTGACATGT
CCAAACGTAACGAACATCATTCGAGATATCATTTCTAAAGAATTACAGACTGATCCTCGTATTACCGCTAGCTTAAACAGGCTCCATTTCCATGATTGCTTTGTTAAT
GTAAGATTTGGT
ACCCTTTAATATTTATTTTCTAGTTAATTTTACTATCTTGATATCTCTATATCCTAATATTTATATATATAGAGAGAGAGAAAGAATTGAAAGTGATATATTATATGTTATTTATTTTTG
TGGTGATAAAAATATTTTCAAAGATTTTAAACGTATATATAATAGAATCCTACCCAATTACTTCACAAGTAATTATTAATACTTCTAAGTAGAAACTAATTAATCAAGTTTGTCGACGAT
TTGTAGGGTTGCGATGCATCGATTTTGCTAGATAATAGTCCGACAATAGAAAGTGAGAAAGAGGCGCTGGCAAACAATAACTCGCTAAGAGGTTTTGATGTTGTCGACAGGATGAAGAGT
AGATTGGAGAGTGCATGTCCTGGAATTGTTTCTTGTGCTGATATACTCACCATAGCATCTCAACTATCTATCAATTTG
GTATAATTTATATTTCATCTGCTAATTATTTATGTTTTATGA
TTATATATGTAGTAGTCCTAATAGATTTACTAAAGAAATCGGTTTGAATTCTTTTCTCGATTATAACTTTTGATAAATTATTATTTTTTAAGTCAGGAGGTCCTTCATGGACAAATCTAT
TGGGAAGGAGAGATAGTTTGACAGCCAGTCGAGCTCTTGCTAATTTAACCATTCCTTCACCATTTGATACTCTTGATCAACTCAAACAAAGGTTTATAAATGTCAGCCTCAATGGTGATA
CCGACTTGGTTGCACTCTCTG
GTATCTGAATCTATTTTTAACTGATCGTTTATCTATTTAGAGTTTGATTGGGATCTTTACCATTTAAATTTTAAGCATTTTATCGCTTCATACAAATCA
TCTGTCATTTTCTCAGGTGCTCACACATTTGGAAGAGCTCGATGCTTAGGATTCTCTCCTCGATTATTCAATTTCAATAACACCAGTGCTCCGGATCCAACTCTCAACACTACCTTTTTA
CCAGTACTTCAACAGATATGTCCTCAAGGTGGGAACCAAAGTGTCATCACTGATCTTGATCTAACTACACCTAATACTTTCGACAACGCCTATTTCTCCAACCTTCAGATTGGAAAGGGT
TTGCTTCAAAGTGATCAAGAATTGCTCTCAACTCCTGGCGCCGATACTGCTAATCTCGTCAATCAATTTAGCAGTAATACTACTGCTTTCTTCGAAGCTTTCGTATTATCTATGATAAGA
ATGGGAAATCTTAGTGTGTTAACGGGAACTGCAGGAGAAATTAGATTGAACTGTAGAGTAATTAATGGAGTCTCTACTTTATCCGATGATAATTTGGTAAGTTCAATATGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTCTTCTTCCACCCTTCACTTCTGCCTTGCAGCTACAGCTCTTTTCTTTACGGCTTTTCTCCGTGGACCTTCCCTGTCTCACGCTCAATTATCTCCTACGTTTTACGACGTGACATGT
CCAAACGTAACGAACATCATTCGAGATATCATTTCTAAAGAATTACAGACTGATCCTCGTATTACCGCTAGCTTAAACAGGCTCCATTTCCATGATTGCTTTGTTAAT
GGTTGCGATGCA
TCGATTTTGCTAGATAATAGTCCGACAATAGAAAGTGAGAAAGAGGCGCTGGCAAACAATAACTCGCTAAGAGGTTTTGATGTTGTCGACAGGATGAAGAGTAGATTGGAGAGTGCATGT
CCTGGAATTGTTTCTTGTGCTGATATACTCACCATAGCATCTCAACTATCTATCAATTTG
TCAGGAGGTCCTTCATGGACAAATCTATTGGGAAGGAGAGATAGTTTGACAGCCAGTCGA
GCTCTTGCTAATTTAACCATTCCTTCACCATTTGATACTCTTGATCAACTCAAACAAAGGTTTATAAATGTCAGCCTCAATGGTGATACCGACTTGGTTGCACTCTCTG
GTGCTCACACA
TTTGGAAGAGCTCGATGCTTAGGATTCTCTCCTCGATTATTCAATTTCAATAACACCAGTGCTCCGGATCCAACTCTCAACACTACCTTTTTACCAGTACTTCAACAGATATGTCCTCAA
GGTGGGAACCAAAGTGTCATCACTGATCTTGATCTAACTACACCTAATACTTTCGACAACGCCTATTTCTCCAACCTTCAGATTGGAAAGGGTTTGCTTCAAAGTGATCAAGAATTGCTC
TCAACTCCTGGCGCCGATACTGCTAATCTCGTCAATCAATTTAGCAGTAATACTACTGCTTTCTTCGAAGCTTTCGTATTATCTATGATAAGAATGGGAAATCTTAGTGTGTTAACGGGA
ACTGCAGGAGAAATTAGATTGAACTGTAGAGTAATTAATGGAGTCTCTACTTTATCCGATGATAATTTGGTAAGTTCAATATGA

Retrieve as FASTA