Entry information : CpapPrx11(CpPOD5 / evm.model.supercontig_152.14)
Entry ID 8745
Creation 2011-06-28 (Qiang Li)
Last sequence changes 2011-10-03 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2019-02-27 (Christophe Dunand)
Peroxidase information: CpapPrx11(CpPOD5 / evm.model.supercontig_152.14)
Name CpapPrx11(CpPOD5 / evm.model.supercontig_152.14)
Class Class III peroxidase    [Orthogroup: Prx010]
Taxonomy Eukaryota Viridiplantae Streptophyta Caricaceae Carica
Organism Carica papaya    [TaxId: 3649 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value CpapPrx11
start..stop
S start..stop
GhyPrx01 622 0 1..330 1..334
PtPrx02 619 0 1..330 1..331
PbPrx03 619 0 1..330 1..331
PbPrx01 619 0 1..330 1..331
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 83694..83921 228 N° 2 83210..83398 189 N° 3 82669..82834 166 N° 4 81907..82316 410
complement(join(81907..82316,82669..82834,83210..83398,83694..83921))


exon

Literature and cross-references CpapPrx11(CpPOD5 / evm.model.supercontig_152.14)
DNA ref. Phytozome 12:   supercontig_152 (83921..81907)
Protein sequence: CpapPrx11(CpPOD5 / evm.model.supercontig_152.14)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   330 (309)
PWM (Da):   %s   37108.12 (34799.9)  
PI (pH):   %s   8.55 (8.38) Peptide Signal:   %s   cut: 22 range:22-330
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAAKALFFFALLSISAFSALAENEEGGNPGLVMNFYKDNCPQAEDIIKEQVRLLYKRHKNTAFSWLRNIFHDCAVESCDASLLLDSTRRSLSEKETDRSFGLRNFRYIDTIKEAVERECPGVVSCADILVLSARDAIVSLGGPYIPLKTGRRDGRKSRADVLEQYLPDHNESVSVVLERFGAIGIDTPGVVALLGAHSVGRTHCVKLVHRLYPEVDPALNPAHVEHMLHKCPDAIPDPKAVQYVRNDRGTPMILDNNYYRNILDNKGLLIVDHQVALDKRTRPYVKKMAKNQNYFFKEFSRAITILSENNPLTGSKGEVRKQCNLANKHH*

Retrieve as FASTA  
Remarks Complete sequence from genomic.
Promoter
Send to BLAST
Send to cis Analysis
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATTAATGCGT TAATTATTTT TTTAATCAAC GTTTATAATC TTGAATCTTG TAACGACTAG ATTCCTAATA TTTTATATTA TCATGAATAA AATTTTAAAT TGCACTGGTA AAGCAGAATT  TAATATTTTA TAAATTATTA GTGGTTGATT TATAATATTT AATTTAATAT AATTTAAAAT TAATTTATTA ATATATTAAT AAAATAATAG TGATTAATTC CAGATTTGTT TTAACAAATT  ATAGAATAAT TAAATTTTTT TATGTAAATT TTTTTAAAAT AATTTTTTAT ATTTTGTAAA ATGACAAATT AATTATTGTA AAATAATCTT CTAATTAATA AATTATTTTT TTGGGTTGGA  TTATTTTATG ATTAAAATCA ATAATTTTTT TAAACAAAAA TTAAAATGAA TAATTAATTA TTGATTAAGT ATCTTAATTA TCTTAAAACC CTAAAATTCG ACATTTAAGA TTTTAAATTT  AATATTTAAA TTTTTTTCCC TCAAATTTAA GTAAACGCCA AGTAATGATT AATGAGTCAT CATTTGTGGG TTCCACTACA CGCATGCAAC TGTGGAGGCA AAAGTGTCGG TGGCTCAGCC  GCCAACGATG ATCCACCCGA TATGGCTTCG GCTTCGGCTT CGGCTTGAGC CGCATTTCAC TTATTGACAT TATTTATTAT TTTTTTAATG AATTTATTTA ATAATACAAT GGGCAATAGA  AAAATTCAAT ATTTAGTACT AAATTACACC TCCTAATTAC TTCTCCTAAG GTAATTTATC TTAAATTAAA TAAATTTTAT TTTTTAACTA TTAATTTTAC TAATAAATCA ATTAAACTAC  ATATTTTTAT ATTTTTGAAT TACATAAAAT CGATATTTTT AATTTAAAAT ATTTAAAAAA ATTAAATATA TATCTATATA TATCCTAACT TAAAACCCAG TTTTTAGATT TTGAAAATTT  TTACCACAGT AAATTTAATT TTAAAATTAC CATTTAAAAA GTTTCTGACT CTATGATTCC TCTGGGTAAT ATATGTAGCT TCATAGCTCA TTATGAAAGA GTCCAAAAAA GGAAAGGTGC  GTGACAAACT TTTTTTTTTG CTTTTATTGA ATTATTTCCC AAGCTTTTAA ATAAATAAAT GAGTAAAATA AATTGTCATT ATGTTTACTT TTTTTTAATA ATATTATTAT ATAATAAACT  AAATTATTAA TTTAAAATAT ACTCGTGAGT TCACAATTTT AATTAATTAC AAGTGGTTAA ATCAATTTTT TTTATTTATT AATTAAACGA TGTACGTATG ATAATTATAA TATTATATAT  AATTTTTAAA TAAAGTTATA AATATACGTA CGCGTTTACT TAATTGATTA ATCAGTATGT CTCTTTCTTT ATAAAAAAAT TATAAATTTA AGTCAGATTA TATTATAATA TGTGTTATCG  TTTAGAATTT AATTTTTTGT ATATATATTA TTTTATTGAT AAATATATAT AAAATTAAAA ATAGGGTTTA ATTTTTAAAA ACTAATTTGG TATTTTTTTT TTAATTATTA AAGACATAAT  TTTATATTAA AAATGAAAAC TTAGGAATTT GAAATCTGTG TTTACTTTTT TTTTTTTTTT AAAAAAAAAA GGAGTATTTG GAGAAGAAGA TAAAACAATA GGAAGAACAA AACTTGTGAA  GAAAATGCAG GGCTGCATGT GCAAGAATTG GACACTTGTA CTAATTTCTA GTTGCCAAAT TGTTTACTTG GCTATAAAAA ATTAACCCTA ACGACAAATA TAGAAGTATA CTATATTTCT  GTACAATAAA TTCTTACCTT ATTTTGAGCA GTAAATGTAG GAGATCGCTC GCTCACAAGT GTAAACCAGA AATTTCCTTT ATATTTTAGT GTTATCCAAC AGTGCTCCCT CTCTTCTTTA 
TTTAACAGGG TACTCAAGAG AGTTCCTGAC CAGATTCATC AAGGTCACTG ACCTTTTTTC AGTGAGAGAG AAAAGAAAAA 

Retrieve as FASTA  
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTGCCAAAGCTCTCTTCTTCTTTGCTCTGCTTTCTATCTCAGCTTTCTCCGCTTTAGCAGAGAATGAGGAAGGAGGAAACCCTGGTCTTGTCATGAACTTTTACAAGGACAATTGT
CCTCAAGCTGAAGATATTATCAAAGAACAAGTCAGGCTTCTCTACAAGCGCCACAAGAACACTGCATTTTCTTGGCTCAGAAACATCTTCCACGACTGTGCCGTTGAG
GTAAAATTAAAG
CCTAGAGACCTGAAAAAGAATTTGTTTCCATTTTACCTTTGGTTGGTTTCTGTTTCTTTGTAAAGATTTTCCAGTTTTTATACGTGGGTCTGGTTTGATTTCTTTTGGTGTGTGCTAAGG
TTATCCAGTAAGTAAAACCCATTGAAGGAAAAAAAAAAAAAAAGGATGTGTGTTTGATTAGTTTCTGTTTTTTGCAATTATTCTCCATTTTTGGTACATGCATTTGGTTTATATTGTTTT
CTTGTGTGCTAAGATTCTCCATTTATTGACTTGTGGGTTTTAGTCTTGTGATGCTTCACTTTTGCTGGACTCGACAAGGAGGAGCCTGTCTGAGAAAGAGACAGACAGGAGCTTTGGACT
GAGAAATTTCAGGTACATTGACACCATCAAGGAAGCTGTGGAGAGGGAATGCCCTGGAGTTGTTTCCTGTGCTGATATTCTTGTGTTGTCTGCTAGAGATGCCATTGTTTCG
GTACTTGT
CTTAACCCTTTTTTGTCTAAACTTGCCTATGTTGAAGCTTCACTTGTTTCTCTCAACTGGGTTTTGTTGATTCACTCTCTTTTACTTACAAGCCAGTTATTTACACAGGCACTGAAAGTC
AGTGCTCATATTCACCTCACCAAAAGCTGTAATTCATCTTATAATCTAAAATCAAATTGTGTCATTTATCCTTTTTTTTTTTTTTTGCTATAAAAGTCTTGTCTACTTCATACTGAGAAG
TCAAAGAACTGAAGCTTTTAGGACCTTACCAGTGAGGCACTTCATTTCCTGTTGTATTTAGTGGATAAAGATAGCTCAGTAAGACATTTATGTTGTATTAGTTATAAAAAATTCTACTTT
GTTTCAGCTTGGCGGACCTTATATCCCTCTCAAGACAGGGAGAAGAGATGGAAGGAAGAGCAGAGCTGATGTGCTGGAGCAGTACCTTCCTGATCATAATGAGAGTGTGTCTGTTGTCCT
TGAAAGGTTTGGAGCTATAGGCATTGACACTCCTGGAGTTGTTGCCCTTCTAG
GTAATAGTTTCTTTTCTTTTTTTTCCCTTCAGTCAGAGCTAAATCAAAGTGACTGAAACTTGTATTT
AACTCATTATCAAGTATTACATGCACAATCAAATGATACTAGAAAATTTTTTAGTTGTTCTACAAGCAGAAACTCATTGGAAGACGGTAGAAATCATTTACCCTTTAAATTTTTACTCCA
TAGTTTCCAGACAAAGATTCGAAAGGAAATGATCATACTGAAATGATATTCCAACTCATAAATTACCTTAAGCATATAATAAGTACTCATGATATGATGAAGTTTGAATAACCTAGCGAT
TTATTGTTGTTGAGTCCTAACTATGGGTTGGTTTGTTTTCAATAGGAGCTCATAGTGTTGGTAGAACCCACTGCGTGAAACTGGTGCACCGGCTCTACCCCGAGGTTGACCCTGCATTGA
ACCCTGCCCATGTTGAACACATGCTCCACAAGTGCCCAGATGCAATCCCAGACCCCAAAGCCGTCCAGTATGTGAGAAATGACAGAGGCACACCCATGATCCTAGACAACAACTACTACA
GGAACATCTTGGACAACAAGGGCTTATTGATTGTTGATCACCAAGTTGCCCTAGACAAGAGGACCAGACCTTATGTCAAGAAAATGGCCAAAAACCAAAACTACTTCTTTAAGGAATTCT
CAAGAGCCATAACCATTCTTTCTGAGAACAATCCACTTACTGGCTCAAAGGGGGAGGTCAGAAAGCAATGCAACCTTGCCAACAAGCACCATTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTGCCAAAGCTCTCTTCTTCTTTGCTCTGCTTTCTATCTCAGCTTTCTCCGCTTTAGCAGAGAATGAGGAAGGAGGAAACCCTGGTCTTGTCATGAACTTTTACAAGGACAATTGT
CCTCAAGCTGAAGATATTATCAAAGAACAAGTCAGGCTTCTCTACAAGCGCCACAAGAACACTGCATTTTCTTGGCTCAGAAACATCTTCCACGACTGTGCCGTTGAG
TCTTGTGATGCT
TCACTTTTGCTGGACTCGACAAGGAGGAGCCTGTCTGAGAAAGAGACAGACAGGAGCTTTGGACTGAGAAATTTCAGGTACATTGACACCATCAAGGAAGCTGTGGAGAGGGAATGCCCT
GGAGTTGTTTCCTGTGCTGATATTCTTGTGTTGTCTGCTAGAGATGCCATTGTTTCG
CTTGGCGGACCTTATATCCCTCTCAAGACAGGGAGAAGAGATGGAAGGAAGAGCAGAGCTGAT
GTGCTGGAGCAGTACCTTCCTGATCATAATGAGAGTGTGTCTGTTGTCCTTGAAAGGTTTGGAGCTATAGGCATTGACACTCCTGGAGTTGTTGCCCTTCTAG
GAGCTCATAGTGTTGGT
AGAACCCACTGCGTGAAACTGGTGCACCGGCTCTACCCCGAGGTTGACCCTGCATTGAACCCTGCCCATGTTGAACACATGCTCCACAAGTGCCCAGATGCAATCCCAGACCCCAAAGCC
GTCCAGTATGTGAGAAATGACAGAGGCACACCCATGATCCTAGACAACAACTACTACAGGAACATCTTGGACAACAAGGGCTTATTGATTGTTGATCACCAAGTTGCCCTAGACAAGAGG
ACCAGACCTTATGTCAAGAAAATGGCCAAAAACCAAAACTACTTCTTTAAGGAATTCTCAAGAGCCATAACCATTCTTTCTGAGAACAATCCACTTACTGGCTCAAAGGGGGAGGTCAGA
AAGCAATGCAACCTTGCCAACAAGCACCATTAA

Retrieve as FASTA