Entry information : CpapPrx16 (CpPOD10 / evm.model.supercontig_19.109)
Entry ID 8750
Creation 2011-06-28 (Qiang Li)
Last sequence changes 2011-10-03 (Qiang Li)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2012-08-16 (Christophe Dunand)
Peroxidase information: CpapPrx16 (CpPOD10 / evm.model.supercontig_19.109)
Name (synonym) CpapPrx16 (CpPOD10 / evm.model.supercontig_19.109)
Class Class III peroxidase     [Orthogroup: Prx008]*
Taxonomy Eukaryota Viridiplantae Streptophyta Caricaceae Carica
Organism Carica papaya    [TaxId: 3649 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value CpapPrx16
start..stop
S start..stop
CpapPrx19 459 4e-164 1..326 1..323
GmPrx328 448 6e-160 9..326 6..320
GmPrx158 448 6e-160 12..326 11..320
CclPrx47 439 2e-156 8..326 4..320
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 726848..727072 225 N° 2 727205..727396 192 N° 3 727652..727817 166 N° 4 727942..728342 401
join(726848..727072,727205..727396,727652..727817,727942..728342)


exon

Literature and cross-references CpapPrx16 (CpPOD10 / evm.model.supercontig_19.109)
DNA ref. Phytozome 12:   supercontig_19 (726848..728342)
Protein sequence: CpapPrx16 (CpPOD10 / evm.model.supercontig_19.109)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   328 (299)
PWM (Da):   %s   35820.75 (32572.0)  
PI (pH):   %s   8.4 (8.14) Peptide Signal:   %s   cut: 29 range:29-327
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAASLLIFTRYCMSLILIVLVGSRSIYAQLSPDFYSHSCPELFPTVKSTMEAAINREGRLGASILRLFFHDCFVKGCDASNLFDDTPTFIGEKKASPNRGSARGFYVIDNIKDEVENMCPGVVSCADILAIAARDAVTILGGPYWDVKLGRRDAMSASQAAANTSIPPPTSNLTQLISSFTSRGLSITDMVALTGGHTIGRARCRNYRARIYNEPNIDMSFSRTRRCRCPRSNMTGNNNLAPVDYQTPGVFDNSFFKNLVNNKGLLHSDQQLYNHGAGPTDSIVLTYSYEPSTFASDFAAAMIKMGDIGVLTGSDGEIRKNCRRVNY*

Retrieve as FASTA  
Remarks Complete sequence from genomic.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCGGCTTCTCTGTTGATTTTCACCAGATATTGCATGTCATTAATTCTTATTGTTTTGGTGGGTAGCAGAAGCATTTATGCTCAGCTTTCACCAGATTTCTACTCCCATTCTTGTCCT
GAACTCTTCCCCACAGTGAAATCCACCATGGAAGCCGCAATTAACAGAGAAGGCCGATTAGGTGCCTCCATTCTTCGATTGTTCTTCCATGACTGCTTCGTCAAA
GTAACCATCTTTTCT
TCTCTCCAATACTTATCTACTGTTGTCCTACTTTATATATATGTTATAAGAGCTTAGGTTTAAATAGTTTTGTTAAATTATTATGTTTGTATTAGCTATCATTCATGGTGATCACAGGGA
TGCGATGCCTCGAATCTGTTTGATGATACTCCCACCTTTATCGGAGAAAAAAAAGCAAGCCCGAATCGTGGTTCTGCTCGTGGATTTTATGTAATTGACAATATCAAGGATGAGGTAGAA
AATATGTGCCCTGGTGTTGTTTCTTGTGCTGATATTTTAGCAATTGCTGCGAGAGATGCAGTTACTATT
GTGAGTGGCATTTATTATCATCTTCAAACTTTCATTCTTATAGCATATTTA
TTTTTAATTTATGTATTCAATTCAATATATTGCTATATACAAGCAAAGACAGGTCATTACGTATATAACATTGAAATCCCATCTAACAAAAATTGGTTCAATTATTGCTATGATTGAATT
CCCATCATTAATTCATGATGTTATATTTTATATATATGTAATATACGTATATGTATATGTATGATGATAATATTGTTGTTATAGCTTGGAGGCCCATACTGGGATGTAAAACTTGGAAGA
AGAGATGCAATGAGTGCAAGCCAAGCTGCTGCAAATACCAGCATTCCTCCTCCAACCTCCAACCTTACTCAACTCATCTCTAGCTTCACTTCTCGTGGCCTTTCCATCACGGACATGGTT
GCCCTTACTG
GTCTCTCTCTCTCTCTTTCTTACACACACACACACACACACACACATACACACACACAAACCTTTTCTCTCTCCCTCTCTCTATATGTATATATATATATATATGTATAT
GTTGGTTTGATCAGGAGGTCATACAATTGGACGAGCAAGGTGCAGAAACTACAGAGCTCGAATCTACAACGAACCCAACATCGACATGTCCTTCTCAAGAACAAGGCGATGCAGGTGTCC
GAGATCTAACATGACCGGAAACAACAATCTGGCGCCGGTTGATTATCAGACTCCGGGAGTTTTTGACAACAGCTTCTTCAAGAACCTGGTCAACAATAAGGGTTTACTCCACTCTGACCA
GCAACTCTACAACCATGGCGCTGGACCCACTGATTCCATAGTGCTCACCTACAGCTACGAACCCAGCACCTTCGCCTCTGATTTCGCCGCTGCCATGATCAAGATGGGAGACATCGGGGT
TCTCACTGGATCAGACGGGGAGATCAGGAAGAATTGCAGGAGGGTGAATTATTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCGGCTTCTCTGTTGATTTTCACCAGATATTGCATGTCATTAATTCTTATTGTTTTGGTGGGTAGCAGAAGCATTTATGCTCAGCTTTCACCAGATTTCTACTCCCATTCTTGTCCT
GAACTCTTCCCCACAGTGAAATCCACCATGGAAGCCGCAATTAACAGAGAAGGCCGATTAGGTGCCTCCATTCTTCGATTGTTCTTCCATGACTGCTTCGTCAAA
GGATGCGATGCCTCG
AATCTGTTTGATGATACTCCCACCTTTATCGGAGAAAAAAAAGCAAGCCCGAATCGTGGTTCTGCTCGTGGATTTTATGTAATTGACAATATCAAGGATGAGGTAGAAAATATGTGCCCT
GGTGTTGTTTCTTGTGCTGATATTTTAGCAATTGCTGCGAGAGATGCAGTTACTATT
CTTGGAGGCCCATACTGGGATGTAAAACTTGGAAGAAGAGATGCAATGAGTGCAAGCCAAGCT
GCTGCAAATACCAGCATTCCTCCTCCAACCTCCAACCTTACTCAACTCATCTCTAGCTTCACTTCTCGTGGCCTTTCCATCACGGACATGGTTGCCCTTACTG
GAGGTCATACAATTGGA
CGAGCAAGGTGCAGAAACTACAGAGCTCGAATCTACAACGAACCCAACATCGACATGTCCTTCTCAAGAACAAGGCGATGCAGGTGTCCGAGATCTAACATGACCGGAAACAACAATCTG
GCGCCGGTTGATTATCAGACTCCGGGAGTTTTTGACAACAGCTTCTTCAAGAACCTGGTCAACAATAAGGGTTTACTCCACTCTGACCAGCAACTCTACAACCATGGCGCTGGACCCACT
GATTCCATAGTGCTCACCTACAGCTACGAACCCAGCACCTTCGCCTCTGATTTCGCCGCTGCCATGATCAAGATGGGAGACATCGGGGTTCTCACTGGATCAGACGGGGAGATCAGGAAG
AATTGCAGGAGGGTGAATTATTGA

Retrieve as FASTA