Entry information : CpapPrx19 (CpPOD9 / evm.model.supercontig_19.93)
Entry ID 8753
Creation 2011-06-28 (Qiang Li)
Last sequence changes 2011-10-03 (Qiang Li)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2012-08-16 (Christophe Dunand)
Peroxidase information: CpapPrx19 (CpPOD9 / evm.model.supercontig_19.93)
Name (synonym) CpapPrx19 (CpPOD9 / evm.model.supercontig_19.93)
Class Class III peroxidase    [Orthogroup: Prx006]
Taxonomy Eukaryota Viridiplantae Streptophyta Caricaceae Carica
Organism Carica papaya    [TaxId: 3649 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value CpapPrx19
start..stop
S start..stop
PatrPrx68 525 0 1..323 1..322
PtPrx68 524 0 1..323 1..322
GmPrx158 524 0 4..323 3..320
PbPrx68 523 0 1..323 1..322
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 639430..639651 222 N° 2 639102..639293 192 N° 3 638393..638558 166 N° 4 637929..638320 392
complement(join(637929..638320,638393..638558,639102..639293,639430..639651))


exon

Literature and cross-references CpapPrx19 (CpPOD9 / evm.model.supercontig_19.93)
DNA ref. Phytozome 11:   supercontig_19 (639651..637929)
Protein sequence: CpapPrx19 (CpPOD9 / evm.model.supercontig_19.93)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   324 (296)
PWM (Da):   %s   35018.58 (32127.0) Transmb domain:   %s   i5-27o
PI (pH):   %s   9.38 (9.16) Peptide Signal:   %s   cut: 28 range:28-323
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MATSLFSRSILSLALLVLVMLTGSTTAQLSTNFYSRSCSKLFPTVKSTMQSAINREKRIGASILRLFFHDCFVNGCDGSILLDDTSSFTGEKNAAPNRRSARGFEVIDNIKSAVENVCPGVVSCADILAIAARDSVSILEGPKWEVKVGRRDARTASQSAANRNIPPPTSNLNQLISSFSNVGLSTRDMVALSGAHTIGQARCTNFRARIYNETNIDSSFATTRQGNCPRSSGSGDDNLAPLDLQTPTDFDNNYFQNLINRKGLLHSDQQLFNGGSTDSLVRTYSNNPGAFNSDFVSAMIKMGDIKPLTGSRGEIRKNCRRVN*

Retrieve as FASTA  
Remarks Complete sequence from genomic.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCGACTTCTCTGTTTTCTAGGTCTATTTTGAGTTTGGCTCTGCTTGTTCTTGTTATGCTGACGGGAAGCACAACTGCTCAGCTCTCAACAAATTTTTACTCTCGTTCTTGTTCCAAA
CTCTTCCCCACTGTCAAATCCACCATGCAATCCGCCATCAACAGAGAAAAAAGAATCGGTGCCTCCATTCTTCGCTTGTTCTTCCATGACTGTTTTGTCAAC
GTATGAAAATATACCAAA
CCGAGTAGAACAAGATCTTTAACATTATAATTTCGTACTTTCCCAAGATATATATAAGCATGGCACGTGTATACACGTATAGATATACTGTAAAGATGTGTTTATTTATGAAATGCAGGG
ATGCGACGGGTCGATTCTACTTGACGACACATCCTCCTTCACCGGCGAGAAAAATGCAGCTCCCAATCGGAGATCGGCTCGTGGGTTCGAAGTGATCGATAACATCAAGTCGGCGGTGGA
GAATGTGTGTCCTGGTGTGGTTTCATGTGCTGACATTTTGGCCATTGCTGCTAGAGACTCTGTTTCCATT
GTAAGCTCCTCTGTTTTCTTGTATCTTCTCGTTAAAAGATTGGTATAGGT
GGGTAATTATATATTATACTTAAGTATTGGAATTGTTGATATGACTTTGAATTTTGGTTTAATTAGTACTCTACTTATATTTTGGTTATGTTAAATATTCTCACTATTTTAGTCATACTA
AATATCTAATATTTTGAGCCTATAATGTTTACAATATTATCAGATAATATAATTTTATTTTTTTATAATAAAAAACTTTTTTTTTGTTGGTAAACGTAGATATTTCTGTCAAACTACGTA
AATTTTATATTTTTCGTTATTTTTTATTTTTTATTTTATCATATTCCGATCATATTAAATATTTTTAGTATTTTAATCGTATTAAAATCAATTGAAATTAATTTAATTTTTTTTAATTTT
ATTGGTAAATACACTCTCATTTTTTATAGTGTAAAACTTTTTGTATCTTTTTTTATTCTTTACATTATATGATTGTTAGCGTATTTGGGATAATCTTTTTATACAAAATTTTGATTGAAA
AATAATTTAATAGCTTGAAGGACCAAAGTGGGAAGTCAAGGTAGGGAGAAGAGATGCAAGAACAGCAAGCCAATCCGCTGCAAACAGAAACATCCCTCCTCCAACTTCAAACCTAAACCA
GCTTATCTCCAGTTTCAGCAACGTGGGTCTTTCCACCAGAGACATGGTTGCTCTCTCCG
GTCAGTCCCCTTCTCTAAATTCCAACTTCTGCTTACCATTTGAGCTGCTTATTTATTAAGC
TGCTTTTTCAGGGGCCCACACGATTGGACAAGCAAGGTGCACGAATTTCAGGGCTCGCATATACAACGAGACCAATATTGATTCTTCTTTCGCAACAACAAGACAAGGGAACTGTCCGAG
GAGCTCTGGATCTGGAGATGATAACTTGGCGCCGCTTGACTTGCAGACTCCCACAGATTTTGACAACAACTATTTTCAGAATTTGATCAACAGGAAAGGCTTGCTCCATTCTGATCAGCA
GCTTTTCAACGGCGGTTCTACTGATTCTCTGGTGCGCACCTATAGTAACAACCCCGGAGCCTTTAACTCTGATTTTGTTTCTGCCATGATCAAGATGGGAGATATCAAACCCCTCACGGG
ATCAAGGGGAGAGATCAGGAAGAATTGCAGGAGGGTGAATTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCGACTTCTCTGTTTTCTAGGTCTATTTTGAGTTTGGCTCTGCTTGTTCTTGTTATGCTGACGGGAAGCACAACTGCTCAGCTCTCAACAAATTTTTACTCTCGTTCTTGTTCCAAA
CTCTTCCCCACTGTCAAATCCACCATGCAATCCGCCATCAACAGAGAAAAAAGAATCGGTGCCTCCATTCTTCGCTTGTTCTTCCATGACTGTTTTGTCAAC
GGATGCGACGGGTCGATT
CTACTTGACGACACATCCTCCTTCACCGGCGAGAAAAATGCAGCTCCCAATCGGAGATCGGCTCGTGGGTTCGAAGTGATCGATAACATCAAGTCGGCGGTGGAGAATGTGTGTCCTGGT
GTGGTTTCATGTGCTGACATTTTGGCCATTGCTGCTAGAGACTCTGTTTCCATT
CTTGAAGGACCAAAGTGGGAAGTCAAGGTAGGGAGAAGAGATGCAAGAACAGCAAGCCAATCCGCT
GCAAACAGAAACATCCCTCCTCCAACTTCAAACCTAAACCAGCTTATCTCCAGTTTCAGCAACGTGGGTCTTTCCACCAGAGACATGGTTGCTCTCTCCG
GGGCCCACACGATTGGACAA
GCAAGGTGCACGAATTTCAGGGCTCGCATATACAACGAGACCAATATTGATTCTTCTTTCGCAACAACAAGACAAGGGAACTGTCCGAGGAGCTCTGGATCTGGAGATGATAACTTGGCG
CCGCTTGACTTGCAGACTCCCACAGATTTTGACAACAACTATTTTCAGAATTTGATCAACAGGAAAGGCTTGCTCCATTCTGATCAGCAGCTTTTCAACGGCGGTTCTACTGATTCTCTG
GTGCGCACCTATAGTAACAACCCCGGAGCCTTTAACTCTGATTTTGTTTCTGCCATGATCAAGATGGGAGATATCAAACCCCTCACGGGATCAAGGGGAGAGATCAGGAAGAATTGCAGG
AGGGTGAATTAA

Retrieve as FASTA