Entry information : CpapPrx21 (evm.model.supercontig_2186.1)
Entry ID 8754
Creation 2011-06-28 (Qiang Li)
Last sequence changes 2011-11-30 (Qiang Li)
Sequence status partial
Reviewer Not yet reviewed
Last annotation changes 2012-01-05 (Qiang LI)
Peroxidase information: CpapPrx21 (evm.model.supercontig_2186.1)
Name (synonym) CpapPrx21 (evm.model.supercontig_2186.1)
Class Class III peroxidase     [Orthogroup: Prx003]*
Taxonomy Eukaryota Viridiplantae Streptophyta Caricaceae Carica
Organism Carica papaya    [TaxId: 3649 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value CpapPrx21
start..stop
S start..stop
QrobPrx01 287 9e-99 1..189 1..189
MePrx24 284 2e-97 1..189 1..189
PtrtrPrx05 281 3e-96 2..189 1..188
AfpPrx03 279 2e-95 1..189 1..189
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 1285..1494 210 N° 2 427..618 192 N° 3 115..303 189  
complement(join(115..303,427..618,1285..1494))


exon

Literature and cross-references CpapPrx21 (evm.model.supercontig_2186.1)
DNA ref. Phytozome 11:   supercontig_2186 (1494..115)
Protein sequence: CpapPrx21 (evm.model.supercontig_2186.1)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   196 (173)
PWM (Da):   %s   21200.98 (18786.7) Transmb domain:   %s   i2-21o
PI (pH):   %s   6.99 (6.91) Peptide Signal:   %s   cut: 24 range:24-196
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MGWFHCLGFIIICGLGVLGLVQGQLKMGFYGESCPKAEKIVEEFVQTHIHNAPSLAAALLRLHFHDCFVRGCDASLLLNSTSENQAEKDSPPNLTVRGYDFIDRVKTLLEQECPGVVSCADIIALVARDSIVSIGGPYWRVPVGRRDGKISRTSEALANIPPPFSNITSLLAFFSRQGLDLKDLTLLSGKTGNVII*

Retrieve as FASTA  
Remarks Partial sequence from genomic. Incorrect prediction from phytozome (3' end is missing because contig ends).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGGATGGTTTCATTGTCTAGGGTTCATAATCATATGTGGTTTAGGAGTTTTAGGGTTAGTCCAAGGTCAACTCAAGATGGGTTTTTATGGTGAGAGTTGCCCAAAAGCTGAGAAGATT
GTGGAGGAATTTGTTCAGACCCACATCCATAATGCACCATCTCTTGCAGCAGCTCTCTTAAGATTGCATTTTCATGATTGCTTTGTTAGG
GTTTGTAAATTCTAATCTTTGTTTAAATGG
AGAAGTGATAATTAGTTTGTTTTTAAATATTTTTCAAAATTAAAAAATAAAATTTAAAATATATTAATCACAATGTAGTTTTGAAGCACCAAATAGTTTTTGTGTGAACCCATATTTTGT
TCAGAGTAGACTAGTAGTTGGGTTAATGGCAACTTTTTCTTTTATTATCAGTTTTCTATACTCGAGTGAAAAAGTAATTGCTACCATCAATTTGGTTCAATTCTTCCTTAAGTTTTCATT
TTATTTTATTTTTTGTTATTATCAGGTTAAAATATCATTAGCATGTAGAATTTTAATTAGAAAGTTTATACTTGAATCAATTTTCCTAGTATATTTAAATGAGATTTGAAATCCCTCTCT
AAGAGATTAAAACAAAAATACAATTAGCCCAAAGATAAAAAGATTTTGATTCTACTTACAACTGGTATTCTATTTAATTATTAAATTCTAAAATCAATAAGTTGAGTGATTTTCTGTAAG
TTTAAGAAAACAGATAGAATATGTAAATTGTCCTAAATAGACCAAATACTGAATGTATGATTCCCATTCCTGGGGTTAGTAAATTTCCTAAGACTAGATCATCTATCTATCTATCTTTCT
TTCTTTTTGAAGATATATTATTCAATAAATTATCAGGGCTGTGATGCATCTCTGCTGCTAAACTCAACTTCAGAAAACCAAGCAGAAAAGGATTCCCCTCCAAATTTGACAGTAAGAGGC
TATGATTTCATTGACAGAGTAAAAACTCTATTGGAACAAGAATGTCCTGGTGTTGTTTCCTGTGCTGACATTATTGCTTTGGTTGCTAGAGATTCAATCGTGTCGATT
GTAAGTCCTAGA
AGCTGACTACCTTTCCTTTACCTGAAAAAGAGTCGCTTCATTATCAGAAAATCCACAAGTTGAAGAGGAATAGTTCAACTTTAATACATATACACACTTTAATTTTGACAGGGAGGACCT
TACTGGAGAGTTCCAGTGGGACGCAGAGATGGAAAAATCTCGAGAACATCAGAAGCCTTAGCTAACATCCCTCCGCCGTTTTCAAACATCACTAGTCTTCTGGCCTTCTTTTCCAGGCAG
GGGCTTGATCTGAAGGACCTCACCTTGCTTTCTGGTAAAACCGGAAATGTCATTATCTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGGATGGTTTCATTGTCTAGGGTTCATAATCATATGTGGTTTAGGAGTTTTAGGGTTAGTCCAAGGTCAACTCAAGATGGGTTTTTATGGTGAGAGTTGCCCAAAAGCTGAGAAGATT
GTGGAGGAATTTGTTCAGACCCACATCCATAATGCACCATCTCTTGCAGCAGCTCTCTTAAGATTGCATTTTCATGATTGCTTTGTTAGG
GGCTGTGATGCATCTCTGCTGCTAAACTCA
ACTTCAGAAAACCAAGCAGAAAAGGATTCCCCTCCAAATTTGACAGTAAGAGGCTATGATTTCATTGACAGAGTAAAAACTCTATTGGAACAAGAATGTCCTGGTGTTGTTTCCTGTGCT
GACATTATTGCTTTGGTTGCTAGAGATTCAATCGTGTCGATT
GGAGGACCTTACTGGAGAGTTCCAGTGGGACGCAGAGATGGAAAAATCTCGAGAACATCAGAAGCCTTAGCTAACATC
CCTCCGCCGTTTTCAAACATCACTAGTCTTCTGGCCTTCTTTTCCAGGCAGGGGCTTGATCTGAAGGACCTCACCTTGCTTTCTGGTAAAACCGGAAATGTCATTATCTAA

Retrieve as FASTA