Entry information : CpapPrx22 (CpPOD15 / evm.model.supercontig_23.12)
Entry ID 8755
Creation 2011-06-28 (Qiang Li)
Last sequence changes 2011-10-03 (Qiang Li)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2012-08-16 (Christophe Dunand)
Peroxidase information: CpapPrx22 (CpPOD15 / evm.model.supercontig_23.12)
Name (synonym) CpapPrx22 (CpPOD15 / evm.model.supercontig_23.12)
Class Class III peroxidase    [Orthogroup: Prx019]
Taxonomy Eukaryota Viridiplantae Streptophyta Caricaceae Carica
Organism Carica papaya    [TaxId: 3649 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value CpapPrx22
start..stop
S start..stop
GmPrx59 509 0 9..323 12..326
LjPrx70 501 0 6..323 7..327
CsaPrx85 471 5e-169 20..323 20..323
RcPrx06 470 1e-168 20..323 26..329
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 96761..96961 201 N° 2 96410..96607 198 N° 3 96115..96280 166 N° 4 95592..95998 407
complement(join(95592..95998,96115..96280,96410..96607,96761..96961))


exon

Literature and cross-references CpapPrx22 (CpPOD15 / evm.model.supercontig_23.12)
DNA ref. Phytozome 11:   supercontig_23 (96961..95592)
Protein sequence: CpapPrx22 (CpPOD15 / evm.model.supercontig_23.12)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   324 (303)
PWM (Da):   %s   36030.59 (33607.2)  
PI (pH):   %s   8.73 (8.40) Peptide Signal:   %s   cut: 21 range:21-323
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MFPRTLLLLLSLILFKTTHAQLHLDYYRNSCPDVESIVRSAVQEKFQQTFVTAPATLRLFFHDCLVRGCDASVLLASRNNRAEKDNPENLSLAGDGFDTVIKAKAAVDNVQECRNKVSCADILVMATRDVIALTGGPSYAVELGRLDGRVSTKASVRHQIPHPDFKLEKLEAMFATHGLTLVDLIALSGAHTIGFSHCSRFSKRLYNFKSKTRIDPTLNPAYARELRGMCPEEVDSRIAISMDQTTPQTFDNVYYKNLERGRGLFTSDQTLFTHKRSRDIVRLFAFNSTAFEIAFVDAITKLGRIGVKTGNQGEIRGDCTIVN

Retrieve as FASTA  
Remarks Complete sequence from genomic.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTTTCCTCGTACTTTGCTCTTGCTACTCTCACTTATTCTTTTTAAAACAACTCATGCCCAGCTTCACTTGGACTACTACAGAAACTCATGCCCAGATGTGGAATCCATTGTTCGATCT
GCGGTCCAAGAGAAGTTTCAGCAAACATTTGTTACAGCACCAGCCACTCTCAGGCTCTTCTTCCATGATTGCCTCGTTCGG
GTTTGTTGCCTTTTTTCATTGAAACTAACAGTGGCTTTT
ACTTCCGTTAATCAAGTTTGCAATGTAAATAATGAAGTTAACCTTTTGTATGTATATGTGTGTATGTAATAATGAAGTTATCTTTTGTGTGGGTATGTGTATATGTGTGTATAGGGGTGT
GATGCTTCTGTGCTACTAGCTTCACGGAATAACAGGGCGGAGAAAGATAATCCAGAGAATCTCTCGCTAGCTGGGGATGGGTTTGATACAGTGATCAAAGCTAAAGCTGCTGTTGATAAC
GTGCAGGAGTGCAGAAACAAAGTTTCTTGTGCTGATATTTTGGTTATGGCCACAAGGGATGTGATTGCATTG
GTAAAACAAGCATTTCTATTATAACATTTTCAATAAGGGGCAACTTTT
TATCATTCAAAGACATTAACTTTTTAGCAAAAGTGAACGTTTTTTAATTGGTTAGTGATCGAGAAGTGTTCTGTGATGCAGACAGGAGGACCATCTTACGCAGTAGAATTGGGAAGACTT
GATGGGAGGGTCTCTACAAAAGCAAGCGTCAGGCACCAAATCCCACATCCTGATTTCAAATTGGAAAAACTCGAAGCCATGTTTGCCACTCACGGACTCACTTTAGTAGATCTCATTGCA
CTTTCAG
GTAATGACAATTTTCTCAAAAGGTTGTAGAAGGAAATCGATATAATGGTATGGTAATAAGTTTTCATGGAGATTCTTGTCATTTTGGAGGAGAGTAATAAAGCGTGTAAAATA
CAGGAGCACATACAATTGGTTTCTCACATTGCAGCCGCTTCTCCAAGAGACTTTATAACTTCAAGAGCAAAACCAGGATTGATCCCACTCTGAATCCAGCATATGCAAGGGAGCTTCGAG
GTATGTGCCCAGAAGAAGTAGACTCAAGAATTGCCATAAGCATGGATCAAACTACACCTCAGACATTTGATAACGTATACTACAAGAATCTCGAACGAGGAAGGGGACTGTTCACATCTG
ATCAAACACTGTTTACTCATAAAAGATCAAGAGATATTGTTCGCTTATTCGCATTCAATTCCACAGCATTTGAAATTGCTTTTGTTGATGCCATTACAAAGCTAGGACGTATAGGGGTCA
AGACCGGAAATCAGGGAGAAATTAGGGGTGATTGCACCATTGTGAACTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTTTCCTCGTACTTTGCTCTTGCTACTCTCACTTATTCTTTTTAAAACAACTCATGCCCAGCTTCACTTGGACTACTACAGAAACTCATGCCCAGATGTGGAATCCATTGTTCGATCT
GCGGTCCAAGAGAAGTTTCAGCAAACATTTGTTACAGCACCAGCCACTCTCAGGCTCTTCTTCCATGATTGCCTCGTTCGG
GGGTGTGATGCTTCTGTGCTACTAGCTTCACGGAATAAC
AGGGCGGAGAAAGATAATCCAGAGAATCTCTCGCTAGCTGGGGATGGGTTTGATACAGTGATCAAAGCTAAAGCTGCTGTTGATAACGTGCAGGAGTGCAGAAACAAAGTTTCTTGTGCT
GATATTTTGGTTATGGCCACAAGGGATGTGATTGCATTG
ACAGGAGGACCATCTTACGCAGTAGAATTGGGAAGACTTGATGGGAGGGTCTCTACAAAAGCAAGCGTCAGGCACCAAATC
CCACATCCTGATTTCAAATTGGAAAAACTCGAAGCCATGTTTGCCACTCACGGACTCACTTTAGTAGATCTCATTGCACTTTCAG
GAGCACATACAATTGGTTTCTCACATTGCAGCCGC
TTCTCCAAGAGACTTTATAACTTCAAGAGCAAAACCAGGATTGATCCCACTCTGAATCCAGCATATGCAAGGGAGCTTCGAGGTATGTGCCCAGAAGAAGTAGACTCAAGAATTGCCATA
AGCATGGATCAAACTACACCTCAGACATTTGATAACGTATACTACAAGAATCTCGAACGAGGAAGGGGACTGTTCACATCTGATCAAACACTGTTTACTCATAAAAGATCAAGAGATATT
GTTCGCTTATTCGCATTCAATTCCACAGCATTTGAAATTGCTTTTGTTGATGCCATTACAAAGCTAGGACGTATAGGGGTCAAGACCGGAAATCAGGGAGAAATTAGGGGTGATTGCACC
ATTGTGAACTAG

Retrieve as FASTA