Entry information : CpapPrx29 (CpPOD16 / evm.model.supercontig_34.24)
Entry ID 8760
Creation 2011-06-28 (Qiang Li)
Last sequence changes 2011-10-03 (Qiang Li)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2012-08-16 (Christophe Dunand)
Peroxidase information: CpapPrx29 (CpPOD16 / evm.model.supercontig_34.24)
Name (synonym) CpapPrx29 (CpPOD16 / evm.model.supercontig_34.24)
Class Class III peroxidase    [Orthogroup: Prx024]
Taxonomy Eukaryota Viridiplantae Streptophyta Caricaceae Carica
Organism Carica papaya    [TaxId: 3649 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value CpapPrx29
start..stop
S start..stop
RcPrx72 444 9e-157 69..385 27..352
VvPrx90 429 8e-151 13..382 11..370
PtPrx36 430 1e-150 68..385 73..382
GmPrx270 426 2e-149 67..385 62..382
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 164153..164494 342 N° 2 165112..165309 198 N° 3 165393..165558 166 N° 4 165934..166394 461
join(164153..164494,165112..165309,165393..165558,165934..166394)


exon

Literature and cross-references CpapPrx29 (CpPOD16 / evm.model.supercontig_34.24)
DNA ref. Phytozome 11:   supercontig_34 (164153..166394)
Protein sequence: CpapPrx29 (CpPOD16 / evm.model.supercontig_34.24)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   389 (360)
PWM (Da):   %s   43358.99 (40131.1)  
PI (pH):   %s   6.51 (5.30) Peptide Signal:   %s   cut: 30 range:30-389
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAISVKKWMFLILVVVVALLLSPRTPKHGDERIPFYFVPIFDPAKSTGFLQSDGEESIFLDPPVLDSGLQYDYYRDTCPQAEAIVRSKIARVYAEHRDIYAGFLRLLFHDCFIQGCDASIFLNDRNEERNRSAERQAVPNKSLRGFDQIDWIKEELEKACPGVVSCADTLVLATRDSLALAGGPVYPVFTGRRDSTESYYAEAMTELPRPDGNITETLGLFNLRGFGERETVTLLGAHNVGKIACQFFQSRLSNFFGTGQPDPTIPSDFLTDLRSKCAVNDSTNKRRSNIESSLGTKQGVSSISVSSGDVFDTHYYQRLLRGRGILFADQQLMADERTARFVRTYASDDGSIFRREFGRVMVKLSNLGVLTGNQGVIRVNCSLPVDHI

Retrieve as FASTA  
Remarks Complete sequence from genomic.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTATATCGGTAAAAAAATGGATGTTCCTTATTCTGGTTGTCGTGGTAGCTCTGCTGCTGTCTCCGAGAACTCCAAAACATGGAGATGAGAGGATCCCGTTTTATTTTGTACCGATT
TTTGATCCAGCTAAGTCAACAGGTTTCCTTCAGAGTGACGGTGAAGAGAGCATTTTCTTGGACCCGCCAGTTCTGGATTCCGGTCTCCAGTACGATTACTATCGCGATACTTGCCCTCAA
GCAGAGGCCATTGTGAGGTCAAAAATCGCTCGGGTCTACGCAGAGCACAGAGACATATATGCTGGTTTCTTGAGGCTTCTTTTCCATGACTGCTTCATTCAG
GTATTTAAATACCGTATT
ATAATGTGCTTCTTCTTTTCCATCGTCTGGATTATGATTTCTTACTTTTCTCTTGTTTTATTTTATGATAATGGTTTTTTATTTTCCTGAAAATTCCTGTGGTTACTGACATTTCAGGGG
TCTGCAATTTCCTGTTTTCGATATTTCTTTAGTTTTCATGTTAGATTTTCTCAGGCTTCTTCTTGTCTATACTTTCTTTAAAACGATGTTCTTACAGTTTTCTGATTCTCATCTCGATGT
TGAGTTGTTTTTACTTCAAATTTGATGAGGTCAATCGCTTATTTTTGCCATTTGATTTCAGCGTCTTTGTTTGTCTCTTTTTGTTAAGTGACTCATTTTCATGCTTAGCATCAGGCCTAT
AATAATTGGTGGATCTTTTTTCCAAATATTTTGTTAATTTGGATACCGGTACTATCTAGTCGATTCCAAATTTGACATTCTTGGTTTAAGTTTTTCTGGTATTTAATTAATTTAATCTGA
TAGATTTGGTAGACATAAATCTGAAAATTTCCGGGGTTTAGAATTACTGATGATTGAATGATACCCCTACTTCAGCTTGCATATTAACATTGTTTTCCTTTCTGGGTTCCATCTATCAGG
GCTGTGATGCTTCGATATTCTTGAATGACAGAAATGAAGAAAGGAACCGCTCTGCCGAGCGTCAGGCTGTGCCTAATAAGAGCTTGAGAGGCTTTGATCAAATCGATTGGATTAAGGAGG
AACTGGAAAAAGCTTGTCCAGGGGTGGTTTCATGTGCTGATACTCTTGTACTTGCCACTAGGGATAGCCTTGCTCTG
GTTTGCACTTCATCCTTCCTTTCTTCTATGTGAATATCTATCT
TTTCCAGCATTCTATATCGGATAACGTACGGAAATTGCAGGCTGGGGGACCAGTGTATCCAGTGTTCACAGGCAGGAGAGACAGTACTGAGTCTTACTATGCTGAAGCAATGACTGAGCT
TCCAAGACCTGATGGGAATATTACGGAGACACTTGGGCTGTTCAACTTAAGGGGTTTCGGTGAGAGAGAAACAGTCACTCTTTTAG
GTACTGGCTAATTCATTTCTTTTTTTTCAAATTT
AAATAATAGAGTTGAATTGATTATTCCAAATATCTAACAGCTACTTAAGCTGGAACTAATTAATATAAATAGTGAGTATAATTCAAAAACAGAAATTTCTGGTTCTATGAATATTAATTT
AGTTGATTATCTCAGAATTTAAAGGATAAAAGTAACTCAATCTATTATTTTATTTGGGTAGGAACCATCATCAGTAAAATTGAACTCAAACACTCTTAATAGAGTGGTCGGAAGTATGAT
CACTGGCTGTATGAATTAATCTATTATTTATTCATTAATAAGTTTTTGTTTTGGATTAGTATGCTTGGTGTTCAGCTAATATTGACTTACTGTGTTTGAAGGAGCACATAATGTTGGAAA
AATTGCTTGCCAGTTCTTTCAGAGTCGACTCTCAAACTTTTTCGGGACAGGTCAACCGGACCCAACAATTCCTTCTGATTTTCTGACTGACTTGAGAAGCAAATGTGCAGTAAATGACAG
CACCAATAAGAGGAGAAGCAACATTGAGTCGAGTTTGGGGACAAAACAAGGAGTATCATCAATTTCAGTGTCATCTGGTGATGTGTTTGACACTCACTATTATCAGAGATTGCTAAGAGG
GAGAGGGATTCTCTTTGCTGATCAACAGTTGATGGCTGACGAGAGAACTGCAAGATTTGTGAGGACTTATGCCTCGGATGATGGTTCTATCTTTAGAAGGGAATTTGGTAGGGTTATGGT
TAAGTTGTCTAACCTTGGTGTCTTGACTGGTAATCAAGGGGTTATCAGGGTCAATTGCTCTTTGCCTGTCGATCATATTTTT

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTATATCGGTAAAAAAATGGATGTTCCTTATTCTGGTTGTCGTGGTAGCTCTGCTGCTGTCTCCGAGAACTCCAAAACATGGAGATGAGAGGATCCCGTTTTATTTTGTACCGATT
TTTGATCCAGCTAAGTCAACAGGTTTCCTTCAGAGTGACGGTGAAGAGAGCATTTTCTTGGACCCGCCAGTTCTGGATTCCGGTCTCCAGTACGATTACTATCGCGATACTTGCCCTCAA
GCAGAGGCCATTGTGAGGTCAAAAATCGCTCGGGTCTACGCAGAGCACAGAGACATATATGCTGGTTTCTTGAGGCTTCTTTTCCATGACTGCTTCATTCAG
GGCTGTGATGCTTCGATA
TTCTTGAATGACAGAAATGAAGAAAGGAACCGCTCTGCCGAGCGTCAGGCTGTGCCTAATAAGAGCTTGAGAGGCTTTGATCAAATCGATTGGATTAAGGAGGAACTGGAAAAAGCTTGT
CCAGGGGTGGTTTCATGTGCTGATACTCTTGTACTTGCCACTAGGGATAGCCTTGCTCTG
GCTGGGGGACCAGTGTATCCAGTGTTCACAGGCAGGAGAGACAGTACTGAGTCTTACTAT
GCTGAAGCAATGACTGAGCTTCCAAGACCTGATGGGAATATTACGGAGACACTTGGGCTGTTCAACTTAAGGGGTTTCGGTGAGAGAGAAACAGTCACTCTTTTAG
GAGCACATAATGTT
GGAAAAATTGCTTGCCAGTTCTTTCAGAGTCGACTCTCAAACTTTTTCGGGACAGGTCAACCGGACCCAACAATTCCTTCTGATTTTCTGACTGACTTGAGAAGCAAATGTGCAGTAAAT
GACAGCACCAATAAGAGGAGAAGCAACATTGAGTCGAGTTTGGGGACAAAACAAGGAGTATCATCAATTTCAGTGTCATCTGGTGATGTGTTTGACACTCACTATTATCAGAGATTGCTA
AGAGGGAGAGGGATTCTCTTTGCTGATCAACAGTTGATGGCTGACGAGAGAACTGCAAGATTTGTGAGGACTTATGCCTCGGATGATGGTTCTATCTTTAGAAGGGAATTTGGTAGGGTT
ATGGTTAAGTTGTCTAACCTTGGTGTCTTGACTGGTAATCAAGGGGTTATCAGGGTCAATTGCTCTTTGCCTGTCGATCATATTTTT

Retrieve as FASTA