Entry information : CpapPrx33 (CpPOD18 / evm.model.supercontig_4.209)
Entry ID 8762
Creation 2011-06-28 (Qiang Li)
Last sequence changes 2012-08-16 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2012-08-16 (Christophe Dunand)
Peroxidase information: CpapPrx33 (CpPOD18 / evm.model.supercontig_4.209)
Name (synonym) CpapPrx33 (CpPOD18 / evm.model.supercontig_4.209)
Class Class III peroxidase    [Orthogroup: Prx036]
Taxonomy Eukaryota Viridiplantae Streptophyta Caricaceae Carica
Organism Carica papaya    [TaxId: 3649 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value CpapPrx33
start..stop
S start..stop
MePrx90 517 0 1..323 1..323
PpePrx62 515 0 1..323 1..324
CsPrx48 506 0 7..323 4..320
CclPrx115 505 0 7..323 4..320
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 3720238..3720456 219 N° 2 3719656..3719844 189 N° 3 3718952..3719515 564  
complement(join(3718952..3719515,3719656..3719844,3720238..3720456))


exon

Literature and cross-references CpapPrx33 (CpPOD18 / evm.model.supercontig_4.209)
DNA ref. Phytozome 11:   supercontig_4 (3720456..3718952)
Protein sequence: CpapPrx33 (CpPOD18 / evm.model.supercontig_4.209)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   324 (299)
PWM (Da):   %s   36055.55 (33171.9)  
PI (pH):   %s   8.56 (8.39) Peptide Signal:   %s   cut: 27 range:25-323
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAVFELKKLFLPTIFLLLLTITHSNSKLDAHYYDQTCPQAEKIILQTVRNASIYDPRVPARLLRMFFHDCFIRGCNASVLLDSTPENQAEKDAPPNISLRSFYVIHDIKSKLEVTCPHTVSCANILTIAARDVVTMSGGPYWNVLKGRKDGRISKANETINLPAPTFNVSQLIQSFGMRGLGVKDLVSLSGGHSLGFSHCSSFASRLHNFSLVHDVDPIMNINFALELKKKCPKPNKDRNAGDFLDSTPSIFDNNYYKLVVAGKALFGSDQALFGDERTRWIVEKFAGDQDLFFKEFATSMVRLGNVGVVENGEVRLNCRLIN*

Retrieve as FASTA  
Remarks Complete sequence from genomic.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTGTTTTCGAGCTGAAGAAACTCTTCCTTCCCACCATTTTCCTTCTCTTGCTAACAATTACGCACTCGAATTCAAAACTCGATGCTCATTACTACGATCAAACATGTCCACAGGCT
GAAAAAATCATACTCCAAACTGTTCGTAATGCTTCCATCTATGATCCTAGAGTTCCTGCTCGTCTTCTTCGCATGTTTTTCCACGACTGTTTCATAAGG
GTATATATATGTAGTGTATTT
TGTATGTGTTTTCTTATTCTCTTACTAGCAGTAGCATATATTTTCATTAGTTTATGTTTAAAAATAAATAGATTTTAATTATTTACAAAAGTTATCTTGAGATTTCACACTCAAAAAATT
TATATGAAGTGTTATTAAAAAGAATAAAAAGTTTAGTTCTTTAAAATTTTAAGTTATCTAAAAACTTTTTTTAAAAAAATTATTTCTTAATAAAATGTTCATTCTCTCTTAATTGTATTT
AATGTAAGTTTTTAGATAAATTTCACAAATACAATTAATTTGTTATAAACATCACCTTAACAGATTAATTTTTATAAATTTATTATTAATAATTAATTATACATTATTTTTTATAATATA
TAATTTTTATAGGGATGTAATGCCTCAGTATTATTGGACTCGACCCCAGAAAACCAAGCAGAAAAAGATGCTCCTCCTAATATTTCTCTTCGATCATTTTATGTTATCCACGACATCAAA
TCTAAACTTGAAGTCACATGTCCACATACAGTTTCTTGTGCTAATATACTTACTATTGCAGCTAGAGATGTTGTAACAATG
GTAATAGTTATATTAGTAATACTACAAATATTGTAGTTT
AACATTCGGTTTAATCATTTTTTCTATATAATACGTATTAATTTACTTTAAATAAATATATATATATATATATAATGTTATTGGAATATTCTTTTTTGTAGTCGGGAGGACCTTATTGGA
ATGTTTTGAAAGGAAGAAAAGATGGACGGATCTCTAAAGCAAACGAAACCATTAATTTACCAGCACCAACCTTCAACGTTTCACAGCTAATACAGAGCTTCGGCATGAGAGGTTTAGGAG
TCAAAGATTTGGTTTCTTTATCGGGAGGACACAGCCTAGGGTTTTCCCATTGTTCTTCTTTTGCTTCAAGATTACATAACTTCAGCTTGGTACATGACGTTGACCCCATCATGAACATTA
ACTTTGCTTTAGAGCTGAAGAAAAAATGCCCGAAGCCAAACAAGGATCGAAATGCAGGAGACTTCTTAGACTCCACTCCCTCCATCTTCGACAACAACTATTACAAACTGGTGGTGGCAG
GGAAGGCCTTGTTTGGATCGGACCAGGCATTGTTTGGCGATGAGAGGACTAGATGGATTGTTGAAAAGTTTGCTGGGGATCAAGATTTATTCTTTAAAGAGTTTGCTACTTCCATGGTGA
GGCTTGGAAATGTTGGAGTGGTGGAAAATGGAGAAGTTAGACTTAATTGTCGCTTGATAAATTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTGTTTTCGAGCTGAAGAAACTCTTCCTTCCCACCATTTTCCTTCTCTTGCTAACAATTACGCACTCGAATTCAAAACTCGATGCTCATTACTACGATCAAACATGTCCACAGGCT
GAAAAAATCATACTCCAAACTGTTCGTAATGCTTCCATCTATGATCCTAGAGTTCCTGCTCGTCTTCTTCGCATGTTTTTCCACGACTGTTTCATAAGG
GGATGTAATGCCTCAGTATTA
TTGGACTCGACCCCAGAAAACCAAGCAGAAAAAGATGCTCCTCCTAATATTTCTCTTCGATCATTTTATGTTATCCACGACATCAAATCTAAACTTGAAGTCACATGTCCACATACAGTT
TCTTGTGCTAATATACTTACTATTGCAGCTAGAGATGTTGTAACAATG
TCGGGAGGACCTTATTGGAATGTTTTGAAAGGAAGAAAAGATGGACGGATCTCTAAAGCAAACGAAACCATT
AATTTACCAGCACCAACCTTCAACGTTTCACAGCTAATACAGAGCTTCGGCATGAGAGGTTTAGGAGTCAAAGATTTGGTTTCTTTATCGGGAGGACACAGCCTAGGGTTTTCCCATTGT
TCTTCTTTTGCTTCAAGATTACATAACTTCAGCTTGGTACATGACGTTGACCCCATCATGAACATTAACTTTGCTTTAGAGCTGAAGAAAAAATGCCCGAAGCCAAACAAGGATCGAAAT
GCAGGAGACTTCTTAGACTCCACTCCCTCCATCTTCGACAACAACTATTACAAACTGGTGGTGGCAGGGAAGGCCTTGTTTGGATCGGACCAGGCATTGTTTGGCGATGAGAGGACTAGA
TGGATTGTTGAAAAGTTTGCTGGGGATCAAGATTTATTCTTTAAAGAGTTTGCTACTTCCATGGTGAGGCTTGGAAATGTTGGAGTGGTGGAAAATGGAGAAGTTAGACTTAATTGTCGC
TTGATAAATTGA

Retrieve as FASTA