Entry information : CpapPrx34 (CpPOD19 / evm.model.supercontig_42.86)
Entry ID 8763
Creation 2011-06-28 (Qiang Li)
Last sequence changes 2011-11-30 (Qiang Li)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2017-02-13 (Christophe Dunand)
Peroxidase information: CpapPrx34 (CpPOD19 / evm.model.supercontig_42.86)
Name (synonym) CpapPrx34 (CpPOD19 / evm.model.supercontig_42.86)
Class Class III peroxidase    [Orthogroup: Prx225]
Taxonomy Eukaryota Viridiplantae Streptophyta Caricaceae Carica
Organism Carica papaya    [TaxId: 3649 ]
Cellular localisation N/D
Tissue type Mixed tissues
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value CpapPrx34
start..stop
S start..stop
CpapPrx35 482 4e-173 1..323 1..319
CpapPrx38 457 2e-163 1..327 1..327
NtPrx10-1B 431 4e-153 7..327 10..330
RcPrx54 429 2e-152 8..327 1..324
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 736345..736755 411 N° 2 736042..736207 166 N° 3 735536..735939 404  
complement(join(735536..735939,736042..736207,736345..736755))


exon

Literature and cross-references CpapPrx34 (CpPOD19 / evm.model.supercontig_42.86)
DNA ref. Phytozome 12:   supercontig_42 (736755..735536)
EST ref. GenBank:   EX261842.1 [5' end]
Protein sequence: CpapPrx34 (CpPOD19 / evm.model.supercontig_42.86)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   327
PWM (Da):   %s   34927.09 Transmb domain:   %s   i7-29o
PI (pH):   %s   10
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MKPNTIRLSIFMLVIFGMHAILVLGRGTGRGTRVGFYSTTCPQVESIVKSAVQARFDTDPTVAPGLLRMHFHDCFVRGCDGSILLEGSNTERTAIPNSNLRGFDVIQNAKTQLEAKCPGVVSCADILALATRDSIVLSGGPSWAVPTGRRDGRVSLQSEVGANIPGPTESVAEQKRKFSVKGLNIQDLVVLVGGHTIGTAGCAVITGRLFNFNGTAGASDPSINPSFLPTLQALCPQGGNPATRVPLDTGSVDKFDTSFFANLRNGKGVLQSDQVLWTDRSTRSFVQRFLTFRAFNPEFTKSMIKMSKIGVLTGLQGEIRKVCNTV

Retrieve as FASTA  
Remarks Complete sequence from genomic (introns 2 and 3).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAAGCCTAATACTATCCGTTTGTCAATATTTATGTTGGTCATATTTGGCATGCATGCCATTTTAGTGCTCGGCCGAGGTACTGGTCGAGGTACTCGTGTTGGCTTCTATTCCACCACA
TGTCCTCAAGTGGAGTCGATCGTCAAATCAGCTGTGCAAGCTCGTTTTGATACCGACCCTACTGTTGCTCCTGGGCTGCTGAGGATGCACTTCCATGATTGTTTTGTTCGTGGTTGTGAT
GGCTCAATTCTCCTTGAAGGATCTAACACTGAGAGAACTGCAATTCCTAACTCAAATTTGAGGGGATTCGATGTCATTCAGAATGCCAAGACTCAACTTGAAGCTAAATGTCCTGGAGTT
GTTTCTTGTGCTGATATTCTTGCTCTAGCTACACGTGACTCTATTGTTCTG
GTAATCAATAATATTTAGTCATGCATCATATATTTATTTTTTTCATCGTATTTATGTTGGTACACAACT
CACTCGTACATAATAAGGTATTATTAATTTATTTTTACCATGTAATAACATGACATTTGTGGATCCAGAGTGGAGGACCTAGTTGGGCAGTTCCTACAGGGCGAAGAGATGGAAGAGTTT
CATTGCAATCTGAAGTTGGTGCCAACATTCCTGGACCCACTGAATCTGTTGCTGAGCAAAAACGAAAATTCTCTGTAAAAGGTCTCAACATCCAGGATCTTGTTGTCCTCGTAG
GTAAAT
ATCGATTCATATATAATATTGATCCTCATCATCTTCTTTATTAATAAGTTATAACTTACCAAGGTAAATATTAATTTATATATGTTCAATTTACAGGCGGACATACTATTGGAACCGCAG
GATGTGCTGTAATTACAGGTAGATTATTCAATTTCAATGGAACAGCTGGTGCATCTGATCCTTCCATAAACCCATCATTCCTCCCTACATTACAAGCTCTTTGTCCTCAAGGTGGCAACC
CAGCAACGCGCGTACCATTAGACACAGGCAGTGTAGACAAATTTGATACCTCTTTCTTTGCAAACTTGAGGAACGGTAAAGGAGTTCTCCAATCCGATCAAGTACTATGGACAGACCGTT
CCACCAGGTCTTTTGTCCAACGATTTTTGACTTTCCGTGCTTTCAATCCTGAATTTACAAAGTCTATGATTAAAATGAGTAAAATTGGAGTCCTTACCGGTCTTCAAGGTGAAATTCGCA
AAGTTTGCAATACAGTAAAC

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAAGCCTAATACTATCCGTTTGTCAATATTTATGTTGGTCATATTTGGCATGCATGCCATTTTAGTGCTCGGCCGAGGTACTGGTCGAGGTACTCGTGTTGGCTTCTATTCCACCACA
TGTCCTCAAGTGGAGTCGATCGTCAAATCAGCTGTGCAAGCTCGTTTTGATACCGACCCTACTGTTGCTCCTGGGCTGCTGAGGATGCACTTCCATGATTGTTTTGTTCGTGGTTGTGAT
GGCTCAATTCTCCTTGAAGGATCTAACACTGAGAGAACTGCAATTCCTAACTCAAATTTGAGGGGATTCGATGTCATTCAGAATGCCAAGACTCAACTTGAAGCTAAATGTCCTGGAGTT
GTTTCTTGTGCTGATATTCTTGCTCTAGCTACACGTGACTCTATTGTTCTG
AGTGGAGGACCTAGTTGGGCAGTTCCTACAGGGCGAAGAGATGGAAGAGTTTCATTGCAATCTGAAGTT
GGTGCCAACATTCCTGGACCCACTGAATCTGTTGCTGAGCAAAAACGAAAATTCTCTGTAAAAGGTCTCAACATCCAGGATCTTGTTGTCCTCGTAG
GCGGACATACTATTGGAACCGCA
GGATGTGCTGTAATTACAGGTAGATTATTCAATTTCAATGGAACAGCTGGTGCATCTGATCCTTCCATAAACCCATCATTCCTCCCTACATTACAAGCTCTTTGTCCTCAAGGTGGCAAC
CCAGCAACGCGCGTACCATTAGACACAGGCAGTGTAGACAAATTTGATACCTCTTTCTTTGCAAACTTGAGGAACGGTAAAGGAGTTCTCCAATCCGATCAAGTACTATGGACAGACCGT
TCCACCAGGTCTTTTGTCCAACGATTTTTGACTTTCCGTGCTTTCAATCCTGAATTTACAAAGTCTATGATTAAAATGAGTAAAATTGGAGTCCTTACCGGTCTTCAAGGTGAAATTCGC
AAAGTTTGCAATACAGTAAAC

Retrieve as FASTA