Entry information : CpapPrx39 (CpPOD23 / evm.model.supercontig_49.72)
Entry ID 8767
Creation 2011-06-28 (Qiang Li)
Last sequence changes 2011-11-30 (Qiang Li)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2012-08-14 (Christophe Dunand)
Peroxidase information: CpapPrx39 (CpPOD23 / evm.model.supercontig_49.72)
Name (synonym) CpapPrx39 (CpPOD23 / evm.model.supercontig_49.72)
Class Class III peroxidase    [Orthogroup: Prx016]
Taxonomy Eukaryota Viridiplantae Streptophyta Caricaceae Carica
Organism Carica papaya    [TaxId: 3649 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value CpapPrx39
start..stop
S start..stop
CclPrx24 455 2e-162 1..328 1..329
CsPrx24 448 1e-159 1..328 1..338
GaPrx08 439 2e-156 10..328 8..327
GhPrx35 439 3e-156 10..328 8..327
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 483597..483827 231 N° 2 483954..484133 180 N° 3 484251..484416 166 N° 4 484546..484955 410
join(483597..483827,483954..484133,484251..484416,484546..484955)


exon

Literature and cross-references CpapPrx39 (CpPOD23 / evm.model.supercontig_49.72)
DNA ref. Phytozome 11:   supercontig_49 (483597..484955)
Protein sequence: CpapPrx39 (CpPOD23 / evm.model.supercontig_49.72)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   328
PWM (Da):   %s   35080.83  
PI (pH):   %s   4.54
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MLVTYNLKAFAFAVTVIMTASLLRCVSVVGQLRVGFYAKTCPSAESIIRKVVQDSTADDPKIAAVLLRLQFHDCFVQGCDASILISTEHGEIEAGGNLGVGGFEIVEDAKTQLEGVCPGVVSCADIVALAARDAVLSVQGPFYEVPTGRRDGRISSVSLAENLPEVDDPIDILKSKFNNKGLSDTDLVLLSAGAHTIGLTACFFMQTRLYNFNSSGGSDPAINPELLPQLQAKCPLGGDVNVKIPLDWGSELTFDDQILRNIKNGFGVIASDARLYDDDNTRRIIDSYVGLASADFMADFAGAMVKMGNIDVKTGLEGEIRRDCRRVN

Retrieve as FASTA  
Remarks Complete sequence from genomic.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTTGGTGACTTACAATCTTAAGGCCTTTGCTTTTGCCGTGACTGTAATCATGACGGCGAGCCTCTTAAGATGTGTTTCAGTGGTGGGTCAACTTCGAGTTGGCTTCTACGCCAAGACA
TGTCCCTCCGCTGAATCTATTATCCGCAAGGTCGTTCAAGACTCCACTGCCGATGATCCCAAGATTGCTGCCGTTCTGCTCAGGCTCCAGTTCCATGATTGCTTTGTTCAA
GTCTCTCTC
TCTCTCTCTCTCTCTCTCTCTCTCTCTCTTTTTCTCTACACCCATATATATATATGTATATGGTCTATCAGTTACAGCTAGGAAATCTCTGAAACATTTACTGGCATTTATTTTCAGGGC
TGTGATGCATCAATACTGATCAGCACCGAGCACGGCGAAATAGAAGCAGGTGGTAACTTGGGCGTGGGCGGTTTCGAGATCGTAGAAGACGCCAAAACGCAGCTGGAAGGGGTTTGCCCT
GGTGTAGTTTCTTGTGCCGATATTGTGGCTTTAGCCGCAAGAGATGCCGTGTTATCG
GTACCCGCAGTTACATATGCATTAAATGCTTCATCTCCTTTTCCTCCCAAATCATTATTACAC
TACTTAACACTTCCCCAGTTTCAGATCATAATGTGTCTTTCCTAAAATTTGCAGGTTCAGGGACCATTCTATGAAGTCCCCACCGGGCGAAGAGATGGAAGGATTTCAAGCGTGTCCTTG
GCCGAGAACTTACCAGAAGTAGATGATCCTATTGATATTCTCAAATCCAAGTTCAATAACAAGGGTCTTTCAGATACCGATCTTGTACTTCTCAGTGCAG
GTATATATATATATATACTT
ATATGTATATATACACACCTATACACTCAAAAGAGTATATGTTTTTGTATATAGATACAAACCCATGAATGTAAATGCGTGATTGTTGAGTTGAGGTACAAATTTGCAGGTGCACATACA
ATTGGACTGACGGCTTGCTTCTTCATGCAAACAAGGCTTTACAATTTTAATTCAAGTGGTGGGTCTGATCCTGCAATCAACCCTGAGTTACTGCCACAGCTCCAGGCTAAATGCCCTCTG
GGTGGAGATGTGAACGTGAAAATACCGCTTGATTGGGGAAGTGAACTGACATTCGACGATCAAATCCTGCGCAACATCAAGAATGGATTCGGTGTGATTGCATCAGATGCCAGGCTTTAT
GATGATGATAACACGAGAAGAATCATTGACTCGTATGTAGGTTTAGCCTCGGCTGATTTCATGGCAGATTTTGCTGGAGCGATGGTGAAAATGGGTAATATTGATGTGAAAACAGGTTTA
GAAGGAGAGATTAGGCGTGATTGTCGTCGTGTTAACTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTTGGTGACTTACAATCTTAAGGCCTTTGCTTTTGCCGTGACTGTAATCATGACGGCGAGCCTCTTAAGATGTGTTTCAGTGGTGGGTCAACTTCGAGTTGGCTTCTACGCCAAGACA
TGTCCCTCCGCTGAATCTATTATCCGCAAGGTCGTTCAAGACTCCACTGCCGATGATCCCAAGATTGCTGCCGTTCTGCTCAGGCTCCAGTTCCATGATTGCTTTGTTCAA
GGCTGTGAT
GCATCAATACTGATCAGCACCGAGCACGGCGAAATAGAAGCAGGTGGTAACTTGGGCGTGGGCGGTTTCGAGATCGTAGAAGACGCCAAAACGCAGCTGGAAGGGGTTTGCCCTGGTGTA
GTTTCTTGTGCCGATATTGTGGCTTTAGCCGCAAGAGATGCCGTGTTATCG
GTTCAGGGACCATTCTATGAAGTCCCCACCGGGCGAAGAGATGGAAGGATTTCAAGCGTGTCCTTGGCC
GAGAACTTACCAGAAGTAGATGATCCTATTGATATTCTCAAATCCAAGTTCAATAACAAGGGTCTTTCAGATACCGATCTTGTACTTCTCAGTGCAG
GTGCACATACAATTGGACTGACG
GCTTGCTTCTTCATGCAAACAAGGCTTTACAATTTTAATTCAAGTGGTGGGTCTGATCCTGCAATCAACCCTGAGTTACTGCCACAGCTCCAGGCTAAATGCCCTCTGGGTGGAGATGTG
AACGTGAAAATACCGCTTGATTGGGGAAGTGAACTGACATTCGACGATCAAATCCTGCGCAACATCAAGAATGGATTCGGTGTGATTGCATCAGATGCCAGGCTTTATGATGATGATAAC
ACGAGAAGAATCATTGACTCGTATGTAGGTTTAGCCTCGGCTGATTTCATGGCAGATTTTGCTGGAGCGATGGTGAAAATGGGTAATATTGATGTGAAAACAGGTTTAGAAGGAGAGATT
AGGCGTGATTGTCGTCGTGTTAACTGA

Retrieve as FASTA