Entry information : CpapPrx43 (CpPOD25 / evm.model.supercontig_55.82)
Entry ID 8771
Creation 2011-06-28 (Qiang Li)
Last sequence changes 2011-10-03 (Qiang Li)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2014-04-10 (Christophe Dunand)
Peroxidase information: CpapPrx43 (CpPOD25 / evm.model.supercontig_55.82)
Name (synonym) CpapPrx43 (CpPOD25 / evm.model.supercontig_55.82)
Class Class III peroxidase    [Orthogroup: Prx018]
Taxonomy Eukaryota Viridiplantae Streptophyta Caricaceae Carica
Organism Carica papaya    [TaxId: 3649 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value CpapPrx43
start..stop
S start..stop
ThasPrx65 552 0 1..328 1..328
CclPrx39 551 0 7..328 5..326
CsPrx06 551 0 7..328 5..326
AlyPrx17 550 0 1..328 1..329
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 511146..511346 201 N° 2 510780..510971 192 N° 3 509355..509948 594  
complement(join(509355..509948,510780..510971,511146..511346))


exon

Literature and cross-references CpapPrx43 (CpPOD25 / evm.model.supercontig_55.82)
DNA ref. Phytozome 12:   supercontig_55 (511346..509355)
Protein sequence: CpapPrx43 (CpPOD25 / evm.model.supercontig_55.82)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   328 (311)
PWM (Da):   %s   36156.15 (34244.0)  
PI (pH):   %s   4.63 (4.63) Peptide Signal:   %s   cut: 18 range:18-328
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MLPLPLLLVFLFPFTVADPAVLQPGFYRDSCPQAETIVRDVMRTALIREPRSVASVMRFQFHDCFVNGCDASLLLDDTPTMVGEKLSLSNINSLRSFEVVDELKDALEKVCPGTVSCADIIIMAARDAVALSGGPDWEVKLGRKDSLTASQKDSDDIMPSPRANASFLINLFDKFSLSVKDLVALSGSHSIGQGRCFSIMFRLYNQSGSGKPDPALDPKYREKLDRLCPLGGDENVTGDLDATPQVFDNQYFKDLVAGRGFLNSDETLYTFPDTRAYVGIFSRDQDEFFKAFVEGMIKMGDLQSGRPGEIRYNCRVVNGRPVDILLES*

Retrieve as FASTA  
Remarks Complete sequence from genomic (introns 1 and 2). No EST.
Promoter
Send to BLAST
Send to cis Analysis
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
AAAGGGTTTC CTTCTTTCTC GCCGTTTCTC TCTTGCGCTG CACTTGCTTC CTGAACTCGA AAGTGGAACA ATTGGGCTGG ACTTGAATTT GTAGAATTTT GGATAAAGCC CGTGAGCCCA  CGCTTTTGAA TTTCGAAGAA AAAACTCTTT TTCTGGGTCG GGTTGAATTT GGGCCGGGCC CCGATATTTC GGATCAATAA CTTGATTTAA CCGGACTACA TTATAATATA ATCTTTTGAA  AATATATTTT TTAAATCTTT TTTCTTATTA TATGATTTTT ATTACCTTAG TTGATTAGTC ATATTACTTA GCTAAAATTT CATTACTTAT AAGCTCCACC TCATCATCAC AAAGCAAGGT  TGGTGGCATT AGTGTCAAAT AAACTTTGCC TATAATAAGA TATATATATA TATATATATA GATATCCATA GAATGGTATG GTCCAATCCT AAACTTGGTT ATGGAAATCT ACACGAGGAT  TGACCCATTA AGAAGAGAGC ATTTATTATT TATATTATAT TGGTATTTCA AGTATCAATA CCAACTACGT AAGCAAGCAA TTCTCAAAAT AAATACTCAT AAAATAAATA TATAAATAAA  TAAATACCCT TTTTGATTTT TTTTTAAATT ATATTATGAT AAAAAGATAA ATCGGGAATA TTTTACTTTT AAATGATCGA AGTATTCTTA TTTAAAAAAA AATAAAGAAA AATAAGAAGA  TTTGTTAAAT AAAATAAATT AAATAGTATT TATATTTATT TATGAGTTGA TGATAATATT CGAAAAAAAT TAATAAATTT AATAAAAAAT TATCACTCCA TAAATGATTA TATAATTATA  TTTTATATAA AAATAAATAA AATTTATTAA CGGAATAAAT GTATTATATT TTTGAGGCGT TTATATAAAT TTAAATTATA TTATTTATGA CGTGGAAGGG GGGGGGGTGT GGGGGCCTCA  ATCTTTGTCC CCTCCAAGTT GGACATCGAG AAATGGGGTT AAAAAACATA CCAAGTGGAG GGAGTGGACC ACCTCAATTG ACAAGCCCAG TTTAACTAAT TTTTCCACCC CCTCCTTTTT  TTTTATATAG ATTACCCAAA ATACCCCCCG AAAATCCGTC ATCGCTAACG AGGTGACGGA GGGTATTTTG GTATTTTTAT ATTAGCAAGA TGGACGTTAC GTTGCCTTCC ACTCTCACAG  GTCTTGTTGG GTGGCACCAA GACCAAAATT AATGTCGAAG ATATTTTTTT TATTTGTATG TCATAATGTA ATTTACTTAC AATTTTTATA TTTGAAATTT CAAATTTATG GCAAATATAT  TAACTATTAA ATTCGACGTA TTGAATCGTT TAAAATTTTG TAATCGATAC GAAAATGGGT TTTTTTAAAA AAAATTGTAA TTGTTAGATT CGGAAAATTG TATTAGATAT AAGTAAAATT  ATATTTACTT ATAATTGAGA CACTTTTTAC AACAATCGAG TGAGAGCGTT ATTAGTTATG AGTAACTTTT TCCGACCCAA ATTACTGTCT AATGCTAAGT TTAAGTTGAT TATATAAATA  ATATATGAAT GTTATTGTGT GTGTGTGTAT GTATATATAG AGATATGTAT AGAGGGAATT GGGAATTGTA GACGCATGAT TTTAAACAAA GACAACCCCA CTGGCTCTCT CTCTCTCTCT  CTATCTCTTT CAGTTAAACA TCCCTCTCAC TTGCTTATTC CACAAATTGC CTCCTCCCCC CACAACCAAA ATACCTGTTT TTGTCCCTTA CACCCTCCTT TTTTACATAT ATGAATTTAT  ATATATATAT ATGTATATGT ATATGTATAT GTATGTATTG AAGTAATTTG CATTCAATAT ATAAATTATA TGAACAGAAG AAAAAGAAAA GAGACAGATT GTATAAATAC ATACGCCAAG 
TCCCACAAAG AAAATACTCT AATTGGATAA ATTTCACCCC ACTACTGCCA AAAGAAGCAA AGGCAAGAAA AAAGAAAAAA 

Retrieve as FASTA  
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCTTCCTCTTCCTCTGCTCCTCGTCTTCCTCTTTCCTTTCACCGTAGCCGACCCAGCAGTTCTTCAGCCCGGATTTTACAGAGATTCATGCCCACAAGCTGAGACCATTGTCAGAGAT
GTCATGAGGACAGCACTGATCAGAGAACCCAGAAGCGTTGCATCTGTCATGCGTTTCCAGTTCCATGATTGCTTTGTAAAT
GTAAACGAAAAAAGAAAAGAACCCTCTTTTTTTCCATGG
GAAATTAGCTGTGTATCTCCATTTTAACGCACTTTTTATCGGGAAGGTTTTCGTGGGTCTTTTTCGGTTTGCTCGTTAAAATCAGTCCGGCTGATATCTGGTTCTCTCTCTCTTTTTTTT
TTTTTTTTTGTGAAGGGTTGTGATGCGTCTCTACTGCTAGATGATACGCCAACAATGGTGGGCGAGAAGCTTTCTCTCTCTAATATAAACTCGCTGAGATCTTTTGAAGTCGTCGATGAG
CTCAAGGACGCGTTGGAGAAGGTTTGCCCAGGAACAGTTTCTTGCGCAGACATCATAATCATGGCGGCCAGAGACGCCGTTGCTCTG
GTAAATTTGTTCATTAACACCTCTGAATTCGAT
CTCCATTAGCTTTTTATTGACCCAGCTAAGCTAACATTCACACACACACACACACACTCATATATATAGATATATATATATATATATCTATGTATGTATATATGCATCCAAACTTTACAC
TGAGACACGCTCTTGTTGGCTTTGAGGAATGAACGCCGGGTATTCAGACAAGTGTATCCTTTTTATGCAGGCTTTATCGAGCAGGCCGATTCCTGAACTTATTCTGTTTGCCTCAATGAT
ACCAGTCTTTGGTTTTTGCTCTCTGTTTAATTTTTCGAAAAGAAAGATTGAATAGGATAATGGGTATTGAAAAAATGCACGCCTTGTATATTATATTATACAAGTCCCTAGGCTTAACAT
TAGTACTTTGACTGGTTTGTGGCCCTTGTATCGGGTTTATCTGGTATTCAGAAAGGGTTTTCTTCTTGCGTGAAAGAGCAGTGACCATTTTTTCTACTATTGAATAATTCAATTTCGCTT
TAAATGGATTTGTCCACTAGCAAGCAATTTTTTATTTGTTTTTCTGAAAGGAAGCTAGTATGTGAATAGCAAAGCCTGCTAAAAAAGAAAGTTCAATATCTCTGTTCCTATTAGTTAGTG
GCAACTTGTGAATGAGGTAAACTCAATTCAAGGATTTGTATAGGGCTATAGACAAGACTTGAAACACAGAATTCTGATTAGTACTTAGTACTTTTCCTGCAAAGTAGATGATCTGGGTGG
GGTTTATGCTTGGTAATCAATTGGTCTTCTTTTGTAATGTACTGAACAAGGTGAGGATTCTGGTTGTTGTTGAACCAGAGTGGAGGACCAGATTGGGAGGTGAAGCTAGGAAGGAAAGAT
AGCTTAACTGCAAGCCAGAAAGACTCAGATGACATTATGCCAAGTCCAAGAGCAAATGCATCTTTTCTCATAAACTTGTTTGATAAATTCAGTCTATCTGTCAAGGACCTTGTAGCACTT
TCCGGGTCACACTCCATTGGCCAAGGGAGGTGCTTTTCAATCATGTTCAGGCTCTACAATCAATCCGGCTCGGGCAAACCTGACCCAGCCCTTGACCCAAAATACAGAGAGAAGCTTGAC
AGGCTATGTCCACTCGGTGGGGATGAGAATGTGACCGGAGATCTTGATGCCACACCGCAAGTTTTTGACAACCAATATTTCAAGGACTTGGTTGCAGGGAGAGGATTCCTTAATTCAGAT
GAAACGCTCTATACTTTCCCGGATACAAGAGCGTATGTCGGGATTTTTAGCAGAGATCAAGATGAGTTCTTCAAGGCCTTTGTTGAAGGAATGATTAAGATGGGTGACTTGCAATCAGGA
CGGCCTGGGGAGATCAGATACAACTGCAGGGTTGTCAATGGCAGGCCTGTTGATATATTGCTCGAGTCTTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCTTCCTCTTCCTCTGCTCCTCGTCTTCCTCTTTCCTTTCACCGTAGCCGACCCAGCAGTTCTTCAGCCCGGATTTTACAGAGATTCATGCCCACAAGCTGAGACCATTGTCAGAGAT
GTCATGAGGACAGCACTGATCAGAGAACCCAGAAGCGTTGCATCTGTCATGCGTTTCCAGTTCCATGATTGCTTTGTAAAT
GGTTGTGATGCGTCTCTACTGCTAGATGATACGCCAACA
ATGGTGGGCGAGAAGCTTTCTCTCTCTAATATAAACTCGCTGAGATCTTTTGAAGTCGTCGATGAGCTCAAGGACGCGTTGGAGAAGGTTTGCCCAGGAACAGTTTCTTGCGCAGACATC
ATAATCATGGCGGCCAGAGACGCCGTTGCTCTG
AGTGGAGGACCAGATTGGGAGGTGAAGCTAGGAAGGAAAGATAGCTTAACTGCAAGCCAGAAAGACTCAGATGACATTATGCCAAGT
CCAAGAGCAAATGCATCTTTTCTCATAAACTTGTTTGATAAATTCAGTCTATCTGTCAAGGACCTTGTAGCACTTTCCGGGTCACACTCCATTGGCCAAGGGAGGTGCTTTTCAATCATG
TTCAGGCTCTACAATCAATCCGGCTCGGGCAAACCTGACCCAGCCCTTGACCCAAAATACAGAGAGAAGCTTGACAGGCTATGTCCACTCGGTGGGGATGAGAATGTGACCGGAGATCTT
GATGCCACACCGCAAGTTTTTGACAACCAATATTTCAAGGACTTGGTTGCAGGGAGAGGATTCCTTAATTCAGATGAAACGCTCTATACTTTCCCGGATACAAGAGCGTATGTCGGGATT
TTTAGCAGAGATCAAGATGAGTTCTTCAAGGCCTTTGTTGAAGGAATGATTAAGATGGGTGACTTGCAATCAGGACGGCCTGGGGAGATCAGATACAACTGCAGGGTTGTCAATGGCAGG
CCTGTTGATATATTGCTCGAGTCTTGA

Retrieve as FASTA